EMAIL THIS PAGE TO A FRIEND

LINC00326

long intergenic non-protein coding RNA 326

Synonyms: NCRNA00326
Species: Human LINC00326(285735)
Gene ID:
86 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001037231 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001037231 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001037231 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001037231 Rosetta Predictions human pricing
XR_040023 Rosetta Predictions human pricing
XR_040024 Rosetta Predictions human pricing
XR_040025 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037231 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00147602 predicted 61
2 SASI_Hs01_00147603 predicted 241
3 SASI_Hs01_00147604 predicted 190
4 SASI_Hs01_00147605 predicted 99
5 SASI_Hs01_00147606 predicted 157
6 SASI_Hs01_00147607 predicted 270
7 SASI_Hs01_00147608 predicted 230
8 SASI_Hs01_00147609 predicted 282
9 SASI_Hs01_00147610 predicted 235
10 SASI_Hs01_00147611 predicted 262
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040023 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00515243 predicted 649
2 SASI_Hs02_00515244 predicted 635
3 SASI_Hs02_00515245 predicted 679
4 SASI_Hs02_00515246 predicted 665
5 SASI_Hs02_00515247 predicted 701
6 SASI_Hs02_00515248 predicted 636
7 SASI_Hs02_00515249 predicted 697
8 SASI_Hs02_00515250 predicted 642
9 SASI_Hs02_00515251 predicted 687
10 SASI_Hs02_00515252 predicted 674
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040024 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00515253 predicted 651
2 SASI_Hs02_00515254 predicted 639
3 SASI_Hs02_00515255 predicted 674
4 SASI_Hs02_00515256 predicted 667
5 SASI_Hs02_00515257 predicted 695
6 SASI_Hs02_00515258 predicted 634
7 SASI_Hs02_00515259 predicted 701
8 SASI_Hs02_00515260 predicted 635
9 SASI_Hs02_00515261 predicted 688
10 SASI_Hs02_00515262 predicted 668
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040025 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00515263 predicted 651
2 SASI_Hs02_00515264 predicted 631
3 SASI_Hs02_00515265 predicted 672
4 SASI_Hs02_00515266 predicted 670
5 SASI_Hs02_00515267 predicted 700
6 SASI_Hs02_00515268 predicted 634
7 SASI_Hs02_00515269 predicted 695
8 SASI_Hs02_00515270 predicted 642
9 SASI_Hs02_00515271 predicted 679
10 SASI_Hs02_00515272 predicted 669
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001037231
LINC00326 MISSION shRNA Bacterial Glycerol Stock
long intergenic non-protein coding RNA 326
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000149731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001037231.1-92s1c1
Sequence:CCGGGATCCAGAAATCAGTCTTCCACTCGAGTGGAAGACTGATTTCTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001037231.1-96s1c1
Sequence:CCGGCAGAAATCAGTCTTCCACTATCTCGAGATAGTGGAAGACTGATTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001037231.1-160s1c1
Sequence:CCGGGAGTGAGAATAAGAACCCTCACTCGAGTGAGGGTTCTTATTCTCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001037231.1-95s1c1
Sequence:CCGGCCAGAAATCAGTCTTCCACTACTCGAGTAGTGGAAGACTGATTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001037231
LINC00326 MISSION shRNA shRNA Plasmid DNA
long intergenic non-protein coding RNA 326
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000149731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001037231.1-92s1c1
Sequence:CCGGGATCCAGAAATCAGTCTTCCACTCGAGTGGAAGACTGATTTCTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001037231.1-96s1c1
Sequence:CCGGCAGAAATCAGTCTTCCACTATCTCGAGATAGTGGAAGACTGATTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001037231.1-160s1c1
Sequence:CCGGGAGTGAGAATAAGAACCCTCACTCGAGTGAGGGTTCTTATTCTCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001037231.1-95s1c1
Sequence:CCGGCCAGAAATCAGTCTTCCACTACTCGAGTAGTGGAAGACTGATTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001037231
LINC00326 MISSION shRNA Lentiviral Transduction Particles
long intergenic non-protein coding RNA 326
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000149731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001037231.1-92s1c1
Sequence:CCGGGATCCAGAAATCAGTCTTCCACTCGAGTGGAAGACTGATTTCTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001037231.1-96s1c1
Sequence:CCGGCAGAAATCAGTCTTCCACTATCTCGAGATAGTGGAAGACTGATTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001037231.1-160s1c1
Sequence:CCGGGAGTGAGAATAAGAACCCTCACTCGAGTGAGGGTTCTTATTCTCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001037231.1-95s1c1
Sequence:CCGGCCAGAAATCAGTCTTCCACTACTCGAGTAGTGGAAGACTGATTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks