EMAIL THIS PAGE TO A FRIEND

LINC00336

long intergenic non-protein coding RNA 336

Synonyms: C6orf227 NCRNA00336
Species: Human LINC00336(401253)
UniProtKB ID: Q6ZUF6
Gene ID:
32 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_207497 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_207497 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_207497 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU035521 MISSION® esiRNA esiRNA human Z93017.6 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_207497 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207497 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00151610 predicted 902
2 SASI_Hs01_00151603 predicted 697
3 SASI_Hs01_00151604 predicted 726
4 SASI_Hs02_00374119 predicted 900
5 SASI_Hs01_00151611 predicted 812
6 SASI_Hs02_00374120 predicted 784
7 SASI_Hs02_00374121 predicted 1234
8 SASI_Hs02_00374122 predicted 1764
9 SASI_Hs02_00374123 predicted 1391
10 SASI_Hs02_00374124 predicted 1762
11 SASI_Hs01_00151602 predicted 697
12 SASI_Hs01_00151605 predicted 714
13 SASI_Hs01_00151606 predicted 694
14 SASI_Hs01_00151607 predicted 709
15 SASI_Hs01_00151608 predicted 709
16 SASI_Hs01_00151609 predicted 925
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207497
LINC00336 MISSION shRNA Bacterial Glycerol Stock
long intergenic non-protein coding RNA 336
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166560    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207497.1-412s1c1
Sequence:CCGGCCTCCGAAAGTGCTAGGATTACTCGAGTAATCCTAGCACTTTCGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166561    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207497.1-459s1c1
Sequence:CCGGCAGGTGGCAAGTCTTTCTGATCTCGAGATCAGAAAGACTTGCCACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165663    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207497.1-469s1c1
Sequence:CCGGGTCTTTCTGATAGGCACTGCTCTCGAGAGCAGTGCCTATCAGAAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165025    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207497.1-421s1c1
Sequence:CCGGGTGCTAGGATTATAGGCGTGACTCGAGTCACGCCTATAATCCTAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165931    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207497.1-1220s1c1
Sequence:CCGGGCCAGGGTCCTGAATTTAGAACTCGAGTTCTAAATTCAGGACCCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166242    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207497.1-490s1c1
Sequence:CCGGCCAAAGTGAATCACACTGTGCCTCGAGGCACAGTGTGATTCACTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164834    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207497.1-377s1c1
Sequence:CCGGCAAACTCCTGAGCTCAAGCAACTCGAGTTGCTTGAGCTCAGGAGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164271    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207497.1-335s1c1
Sequence:CCGGCCTTAGTGAGACAAGGTTTCACTCGAGTGAAACCTTGTCTCACTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162829    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207497.1-336s1c1
Sequence:CCGGCTTAGTGAGACAAGGTTTCACCTCGAGGTGAAACCTTGTCTCACTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162900    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207497.1-734s1c1
Sequence:CCGGGAGATGATGAATGGACGGAAACTCGAGTTTCCGTCCATTCATCATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162985    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207497.1-342s1c1
Sequence:CCGGGAGACAAGGTTTCACCATGTTCTCGAGAACATGGTGAAACCTTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163254    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207497.1-631s1c1
Sequence:CCGGGCAAGCTAATGCCAGACTAAACTCGAGTTTAGTCTGGCATTAGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163527    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207497.1-823s1c1
Sequence:CCGGGCCTAACCTTTAAAGGCTGATCTCGAGATCAGCCTTTAAAGGTTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207497
LINC00336 MISSION shRNA shRNA Plasmid DNA
long intergenic non-protein coding RNA 336
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166560    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207497.1-412s1c1
Sequence:CCGGCCTCCGAAAGTGCTAGGATTACTCGAGTAATCCTAGCACTTTCGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166561    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207497.1-459s1c1
Sequence:CCGGCAGGTGGCAAGTCTTTCTGATCTCGAGATCAGAAAGACTTGCCACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165663    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207497.1-469s1c1
Sequence:CCGGGTCTTTCTGATAGGCACTGCTCTCGAGAGCAGTGCCTATCAGAAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165025    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207497.1-421s1c1
Sequence:CCGGGTGCTAGGATTATAGGCGTGACTCGAGTCACGCCTATAATCCTAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165931    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207497.1-1220s1c1
Sequence:CCGGGCCAGGGTCCTGAATTTAGAACTCGAGTTCTAAATTCAGGACCCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166242    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207497.1-490s1c1
Sequence:CCGGCCAAAGTGAATCACACTGTGCCTCGAGGCACAGTGTGATTCACTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164834    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207497.1-377s1c1
Sequence:CCGGCAAACTCCTGAGCTCAAGCAACTCGAGTTGCTTGAGCTCAGGAGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164271    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207497.1-335s1c1
Sequence:CCGGCCTTAGTGAGACAAGGTTTCACTCGAGTGAAACCTTGTCTCACTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162829    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207497.1-336s1c1
Sequence:CCGGCTTAGTGAGACAAGGTTTCACCTCGAGGTGAAACCTTGTCTCACTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162900    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207497.1-734s1c1
Sequence:CCGGGAGATGATGAATGGACGGAAACTCGAGTTTCCGTCCATTCATCATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162985    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207497.1-342s1c1
Sequence:CCGGGAGACAAGGTTTCACCATGTTCTCGAGAACATGGTGAAACCTTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163254    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207497.1-631s1c1
Sequence:CCGGGCAAGCTAATGCCAGACTAAACTCGAGTTTAGTCTGGCATTAGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163527    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207497.1-823s1c1
Sequence:CCGGGCCTAACCTTTAAAGGCTGATCTCGAGATCAGCCTTTAAAGGTTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207497
LINC00336 MISSION shRNA Lentiviral Transduction Particles
long intergenic non-protein coding RNA 336
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166560    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207497.1-412s1c1
Sequence:CCGGCCTCCGAAAGTGCTAGGATTACTCGAGTAATCCTAGCACTTTCGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166561    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207497.1-459s1c1
Sequence:CCGGCAGGTGGCAAGTCTTTCTGATCTCGAGATCAGAAAGACTTGCCACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165663    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207497.1-469s1c1
Sequence:CCGGGTCTTTCTGATAGGCACTGCTCTCGAGAGCAGTGCCTATCAGAAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165025    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207497.1-421s1c1
Sequence:CCGGGTGCTAGGATTATAGGCGTGACTCGAGTCACGCCTATAATCCTAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165931    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207497.1-1220s1c1
Sequence:CCGGGCCAGGGTCCTGAATTTAGAACTCGAGTTCTAAATTCAGGACCCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166242    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207497.1-490s1c1
Sequence:CCGGCCAAAGTGAATCACACTGTGCCTCGAGGCACAGTGTGATTCACTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164834    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207497.1-377s1c1
Sequence:CCGGCAAACTCCTGAGCTCAAGCAACTCGAGTTGCTTGAGCTCAGGAGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164271    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207497.1-335s1c1
Sequence:CCGGCCTTAGTGAGACAAGGTTTCACTCGAGTGAAACCTTGTCTCACTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162829    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207497.1-336s1c1
Sequence:CCGGCTTAGTGAGACAAGGTTTCACCTCGAGGTGAAACCTTGTCTCACTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162900    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207497.1-734s1c1
Sequence:CCGGGAGATGATGAATGGACGGAAACTCGAGTTTCCGTCCATTCATCATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162985    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207497.1-342s1c1
Sequence:CCGGGAGACAAGGTTTCACCATGTTCTCGAGAACATGGTGAAACCTTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163254    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207497.1-631s1c1
Sequence:CCGGGCAAGCTAATGCCAGACTAAACTCGAGTTTAGTCTGGCATTAGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163527    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207497.1-823s1c1
Sequence:CCGGGCCTAACCTTTAAAGGCTGATCTCGAGATCAGCCTTTAAAGGTTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks