EMAIL THIS PAGE TO A FRIEND

LINC00467

long intergenic non-protein coding RNA 467

Synonyms: C1orf97 RP11-318L16.3
Species: Human LINC00467(84791)
UniProtKB ID: Q9BRT7
Gene ID:
53 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032705 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032705 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032705 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU126091 MISSION® esiRNA esiRNA human C1orf97 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032705 Rosetta Predictions human pricing
XR_040057 Rosetta Predictions human pricing
XR_040058 Rosetta Predictions human pricing
XR_040059 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032705 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00125744 predicted 142
2 SASI_Hs01_00125745 predicted 239
3 SASI_Hs01_00125746 predicted 480
4 SASI_Hs01_00125747 predicted 617
5 SASI_Hs01_00125748 predicted 318
6 SASI_Hs01_00125749 predicted 655
7 SASI_Hs01_00125750 predicted 642
8 SASI_Hs01_00125751 predicted 563
9 SASI_Hs01_00125752 predicted 277
10 SASI_Hs01_00125753 predicted 241
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040057 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00515523 predicted 511
2 SASI_Hs02_00515524 predicted 645
3 SASI_Hs02_00515525 predicted 685
4 SASI_Hs02_00515526 predicted 663
5 SASI_Hs02_00515527 predicted 589
6 SASI_Hs02_00515528 predicted 531
7 SASI_Hs02_00515529 predicted 554
8 SASI_Hs02_00515530 predicted 639
9 SASI_Hs02_00515531 predicted 548
10 SASI_Hs02_00515532 predicted 491
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040058 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00515533 predicted 511
2 SASI_Hs02_00515534 predicted 651
3 SASI_Hs02_00515535 predicted 686
4 SASI_Hs02_00515536 predicted 658
5 SASI_Hs02_00515537 predicted 587
6 SASI_Hs02_00515538 predicted 528
7 SASI_Hs02_00515539 predicted 555
8 SASI_Hs02_00515540 predicted 646
9 SASI_Hs02_00515541 predicted 553
10 SASI_Hs02_00515542 predicted 493
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040059 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00515543 predicted 510
2 SASI_Hs02_00515544 predicted 651
3 SASI_Hs02_00515545 predicted 683
4 SASI_Hs02_00515546 predicted 659
5 SASI_Hs02_00515547 predicted 581
6 SASI_Hs02_00515548 predicted 534
7 SASI_Hs02_00515549 predicted 550
8 SASI_Hs02_00515550 predicted 643
9 SASI_Hs02_00515551 predicted 553
10 SASI_Hs02_00515552 predicted 495
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032705
VALIDATED
LINC00467 MISSION shRNA Bacterial Glycerol Stock
long intergenic non-protein coding RNA 467
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000116077    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032705.2-468s1c1
Sequence:CCGGCCTTTCCAAGAGGGACTGAAACTCGAGTTTCAGTCCCTCTTGGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032705.2-174s1c1
Sequence:CCGGGCTGGCAAATATGAAGGTAAACTCGAGTTTACCTTCATATTTGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032705.2-244s1c1
Sequence:CCGGGACATAGATCAGTGACGTCTTCTCGAGAAGACGTCACTGATCTATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032705.2-318s1c1
Sequence:CCGGCAGACAGATTCAAGTATTGAACTCGAGTTCAATACTTGAATCTGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032705.2-185s1c1
Sequence:CCGGTGAAGGTAAACACAAACGAAACTCGAGTTTCGTTTGTGTTTACCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032705
VALIDATED
LINC00467 MISSION shRNA shRNA Plasmid DNA
long intergenic non-protein coding RNA 467
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000116077    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032705.2-468s1c1
Sequence:CCGGCCTTTCCAAGAGGGACTGAAACTCGAGTTTCAGTCCCTCTTGGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032705.2-174s1c1
Sequence:CCGGGCTGGCAAATATGAAGGTAAACTCGAGTTTACCTTCATATTTGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032705.2-244s1c1
Sequence:CCGGGACATAGATCAGTGACGTCTTCTCGAGAAGACGTCACTGATCTATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032705.2-318s1c1
Sequence:CCGGCAGACAGATTCAAGTATTGAACTCGAGTTCAATACTTGAATCTGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032705.2-185s1c1
Sequence:CCGGTGAAGGTAAACACAAACGAAACTCGAGTTTCGTTTGTGTTTACCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032705
VALIDATED
LINC00467 MISSION shRNA Lentiviral Transduction Particles
long intergenic non-protein coding RNA 467
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000116077    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032705.2-468s1c1
Sequence:CCGGCCTTTCCAAGAGGGACTGAAACTCGAGTTTCAGTCCCTCTTGGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032705.2-174s1c1
Sequence:CCGGGCTGGCAAATATGAAGGTAAACTCGAGTTTACCTTCATATTTGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032705.2-244s1c1
Sequence:CCGGGACATAGATCAGTGACGTCTTCTCGAGAAGACGTCACTGATCTATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032705.2-318s1c1
Sequence:CCGGCAGACAGATTCAAGTATTGAACTCGAGTTCAATACTTGAATCTGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032705.2-185s1c1
Sequence:CCGGTGAAGGTAAACACAAACGAAACTCGAGTTTCGTTTGTGTTTACCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks