EMAIL THIS PAGE TO A FRIEND

LINC00652

long intergenic non-protein coding RNA 652

Synonyms: HSPC072
Species: Human LINC00652(29075)
Gene ID:
30 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014162 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014162 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014162 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014162 Rosetta Predictions human pricing
XR_017985 Rosetta Predictions human pricing
XR_041836 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014162 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00077528 predicted 561
2 SASI_Hs01_00077529 predicted 570
3 SASI_Hs01_00077530 predicted 521
4 SASI_Hs01_00077531 predicted 680
5 SASI_Hs01_00077532 predicted 549
6 SASI_Hs01_00077533 predicted 480
7 SASI_Hs01_00077534 predicted 701
8 SASI_Hs01_00077535 predicted 507
9 SASI_Hs01_00077536 predicted 558
10 SASI_Hs01_00077537 predicted 481
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_017985 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00495185 predicted 157
2 SASI_Hs02_00495186 predicted 171
3 SASI_Hs02_00495187 predicted 226
4 SASI_Hs02_00495188 predicted 198
5 SASI_Hs02_00495189 predicted 120
6 SASI_Hs02_00495190 predicted 123
7 SASI_Hs02_00495191 predicted 230
8 SASI_Hs02_00495192 predicted 210
9 SASI_Hs02_00495193 predicted 131
10 SASI_Hs02_00495194 predicted 163
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041836 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00530763 predicted 163
2 SASI_Hs02_00530764 predicted 169
3 SASI_Hs02_00530765 predicted 221
4 SASI_Hs02_00530766 predicted 207
5 SASI_Hs02_00530767 predicted 121
6 SASI_Hs02_00530768 predicted 129
7 SASI_Hs02_00530769 predicted 228
8 SASI_Hs02_00530770 predicted 207
9 SASI_Hs02_00530771 predicted 125
10 SASI_Hs02_00530772 predicted 161
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014162
LINC00652 MISSION shRNA Bacterial Glycerol Stock
long intergenic non-protein coding RNA 652
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000144001    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014162.1-452s1c1
Sequence:CCGGCAACTGGTTCAAATAAGCACACTCGAGTGTGCTTATTTGAACCAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143928    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014162.1-511s1c1
Sequence:CCGGCTCAGCTCCTTATTTATCACTCTCGAGAGTGATAAATAAGGAGCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014162.1-567s1c1
Sequence:CCGGGCTGGAATCCTCTTCCTGAAACTCGAGTTTCAGGAAGAGGATTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142561    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014162.1-503s1c1
Sequence:CCGGGTGTTCACCTCAGCTCCTTATCTCGAGATAAGGAGCTGAGGTGAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142877    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014162.1-581s1c1
Sequence:CCGGCCTGAAATTGCTGTCTTCTTGCTCGAGCAAGAAGACAGCAATTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122863    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014162.1-695s1c1
Sequence:CCGGGCATCCCAAGTCTGTCCTTATCTCGAGATAAGGACAGACTTGGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014162.1-554s1c1
Sequence:CCGGGCTAGTGACATGAGCTGGAATCTCGAGATTCCAGCTCATGTCACTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014162.1-384s1c1
Sequence:CCGGCACAAGCACATTTCAAGATTTCTCGAGAAATCTTGAAATGTGCTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014162.1-443s1c1
Sequence:CCGGCAAGGAACACAACTGGTTCAACTCGAGTTGAACCAGTTGTGTTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014162
LINC00652 MISSION shRNA shRNA Plasmid DNA
long intergenic non-protein coding RNA 652
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000144001    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014162.1-452s1c1
Sequence:CCGGCAACTGGTTCAAATAAGCACACTCGAGTGTGCTTATTTGAACCAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143928    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014162.1-511s1c1
Sequence:CCGGCTCAGCTCCTTATTTATCACTCTCGAGAGTGATAAATAAGGAGCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014162.1-567s1c1
Sequence:CCGGGCTGGAATCCTCTTCCTGAAACTCGAGTTTCAGGAAGAGGATTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142561    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014162.1-503s1c1
Sequence:CCGGGTGTTCACCTCAGCTCCTTATCTCGAGATAAGGAGCTGAGGTGAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142877    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014162.1-581s1c1
Sequence:CCGGCCTGAAATTGCTGTCTTCTTGCTCGAGCAAGAAGACAGCAATTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122863    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014162.1-695s1c1
Sequence:CCGGGCATCCCAAGTCTGTCCTTATCTCGAGATAAGGACAGACTTGGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014162.1-554s1c1
Sequence:CCGGGCTAGTGACATGAGCTGGAATCTCGAGATTCCAGCTCATGTCACTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014162.1-384s1c1
Sequence:CCGGCACAAGCACATTTCAAGATTTCTCGAGAAATCTTGAAATGTGCTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014162.1-443s1c1
Sequence:CCGGCAAGGAACACAACTGGTTCAACTCGAGTTGAACCAGTTGTGTTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014162
LINC00652 MISSION shRNA Lentiviral Transduction Particles
long intergenic non-protein coding RNA 652
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000144001    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014162.1-452s1c1
Sequence:CCGGCAACTGGTTCAAATAAGCACACTCGAGTGTGCTTATTTGAACCAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143928    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014162.1-511s1c1
Sequence:CCGGCTCAGCTCCTTATTTATCACTCTCGAGAGTGATAAATAAGGAGCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014162.1-567s1c1
Sequence:CCGGGCTGGAATCCTCTTCCTGAAACTCGAGTTTCAGGAAGAGGATTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142561    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014162.1-503s1c1
Sequence:CCGGGTGTTCACCTCAGCTCCTTATCTCGAGATAAGGAGCTGAGGTGAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142877    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014162.1-581s1c1
Sequence:CCGGCCTGAAATTGCTGTCTTCTTGCTCGAGCAAGAAGACAGCAATTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122863    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014162.1-695s1c1
Sequence:CCGGGCATCCCAAGTCTGTCCTTATCTCGAGATAAGGACAGACTTGGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014162.1-554s1c1
Sequence:CCGGGCTAGTGACATGAGCTGGAATCTCGAGATTCCAGCTCATGTCACTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014162.1-384s1c1
Sequence:CCGGCACAAGCACATTTCAAGATTTCTCGAGAAATCTTGAAATGTGCTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014162.1-443s1c1
Sequence:CCGGCAAGGAACACAACTGGTTCAACTCGAGTTGAACCAGTTGTGTTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks