EMAIL THIS PAGE TO A FRIEND

LINC00839

long intergenic non-protein coding RNA 839

Species: Human LINC00839(84856)
Gene ID:
32 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032770 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032770 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032770 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032770 Rosetta Predictions human pricing
XR_017966 Rosetta Predictions human pricing
XR_040081 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032770 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00172143 predicted 234
2 SASI_Hs01_00172144 predicted 247
3 SASI_Hs01_00172145 predicted 326
4 SASI_Hs01_00172146 predicted 246
5 SASI_Hs01_00172147 predicted 234
6 SASI_Hs01_00172148 predicted 247
7 SASI_Hs01_00172149 predicted 318
8 SASI_Hs01_00172150 predicted 317
9 SASI_Hs01_00172151 predicted 210
10 SASI_Hs01_00172152 predicted 95
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_017966 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00495117 predicted 238
2 SASI_Hs02_00495118 predicted 248
3 SASI_Hs02_00495119 predicted 327
4 SASI_Hs02_00495120 predicted 244
5 SASI_Hs02_00495121 predicted 246
6 SASI_Hs02_00495122 predicted 288
7 SASI_Hs02_00495123 predicted 321
8 SASI_Hs02_00495124 predicted 317
9 SASI_Hs02_00495125 predicted 234
10 SASI_Hs02_00495126 predicted 210
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040081 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00515733 predicted 231
2 SASI_Hs02_00515734 predicted 248
3 SASI_Hs02_00515735 predicted 325
4 SASI_Hs02_00515736 predicted 250
5 SASI_Hs02_00515737 predicted 250
6 SASI_Hs02_00515738 predicted 288
7 SASI_Hs02_00515739 predicted 325
8 SASI_Hs02_00515740 predicted 324
9 SASI_Hs02_00515741 predicted 231
10 SASI_Hs02_00515742 predicted 214
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032770
LINC00839 MISSION shRNA Bacterial Glycerol Stock
long intergenic non-protein coding RNA 839
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000183863    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032770.2-910s1c1
Sequence:CCGGCCAGCTACAATGAGTAATCTACTCGAGTAGATTACTCATTGTAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183465    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032770.2-2070s1c1
Sequence:CCGGGCCCAACATATTCCTTTAATTCTCGAGAATTAAAGGAATATGTTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181209    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032770.2-477s1c1
Sequence:CCGGCTGTGGCATCCATCTCTGAAACTCGAGTTTCAGAGATGGATGCCACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183780    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032770.2-1283s1c1
Sequence:CCGGCCTCTCTAAGTATGCTTTGTTCTCGAGAACAAAGCATACTTAGAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032770
LINC00839 MISSION shRNA shRNA Plasmid DNA
long intergenic non-protein coding RNA 839
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000183863    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032770.2-910s1c1
Sequence:CCGGCCAGCTACAATGAGTAATCTACTCGAGTAGATTACTCATTGTAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183465    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032770.2-2070s1c1
Sequence:CCGGGCCCAACATATTCCTTTAATTCTCGAGAATTAAAGGAATATGTTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181209    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032770.2-477s1c1
Sequence:CCGGCTGTGGCATCCATCTCTGAAACTCGAGTTTCAGAGATGGATGCCACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183780    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032770.2-1283s1c1
Sequence:CCGGCCTCTCTAAGTATGCTTTGTTCTCGAGAACAAAGCATACTTAGAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032770
LINC00839 MISSION shRNA Lentiviral Transduction Particles
long intergenic non-protein coding RNA 839
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000183863    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032770.2-910s1c1
Sequence:CCGGCCAGCTACAATGAGTAATCTACTCGAGTAGATTACTCATTGTAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183465    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032770.2-2070s1c1
Sequence:CCGGGCCCAACATATTCCTTTAATTCTCGAGAATTAAAGGAATATGTTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181209    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032770.2-477s1c1
Sequence:CCGGCTGTGGCATCCATCTCTGAAACTCGAGTTTCAGAGATGGATGCCACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183780    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032770.2-1283s1c1
Sequence:CCGGCCTCTCTAAGTATGCTTTGTTCTCGAGAACAAAGCATACTTAGAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks