EMAIL THIS PAGE TO A FRIEND

LINC00955

long intergenic non-protein coding RNA 955

Species: Human LINC00955(285492)
Gene ID:
40 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173661 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173661 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173661 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173661 Rosetta Predictions human pricing
XR_040705 Rosetta Predictions human pricing
XR_040706 Rosetta Predictions human pricing
XR_040707 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173661 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00204598 predicted 345
2 SASI_Hs01_00204599 predicted 348
3 SASI_Hs01_00204600 predicted 388
4 SASI_Hs01_00204601 predicted 858
5 SASI_Hs01_00204602 predicted 474
6 SASI_Hs01_00204603 predicted 510
7 SASI_Hs01_00204604 predicted 926
8 SASI_Hs01_00204605 predicted 896
9 SASI_Hs01_00204606 predicted 934
10 SASI_Hs01_00204607 predicted 933
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040705 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00521177 predicted 352
2 SASI_Hs02_00521178 predicted 266
3 SASI_Hs02_00521179 predicted 336
4 SASI_Hs02_00521180 predicted 343
5 SASI_Hs02_00521181 predicted 297
6 SASI_Hs02_00521182 predicted 243
7 SASI_Hs02_00521183 predicted 312
8 SASI_Hs02_00521184 predicted 251
9 SASI_Hs02_00521185 predicted 249
10 SASI_Hs02_00521186 predicted 376
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040706 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00521187 predicted 265
2 SASI_Hs02_00521188 predicted 296
3 SASI_Hs02_00521189 predicted 255
4 SASI_Hs02_00521190 predicted 254
5 SASI_Hs02_00521191 predicted 338
6 SASI_Hs02_00521192 predicted 323
7 SASI_Hs02_00521193 predicted 239
8 SASI_Hs02_00521194 predicted 314
9 SASI_Hs02_00521195 predicted 349
10 SASI_Hs02_00521196 predicted 245
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040707 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00521197 predicted 351
2 SASI_Hs02_00521198 predicted 268
3 SASI_Hs02_00521199 predicted 336
4 SASI_Hs02_00521200 predicted 346
5 SASI_Hs02_00521201 predicted 299
6 SASI_Hs02_00521202 predicted 237
7 SASI_Hs02_00521203 predicted 319
8 SASI_Hs02_00521204 predicted 247
9 SASI_Hs02_00521205 predicted 254
10 SASI_Hs02_00521206 predicted 374
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173661
LINC00955 MISSION shRNA Bacterial Glycerol Stock
long intergenic non-protein coding RNA 955
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000172440    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173661.1-598s1c1
Sequence:CCGGCACACACACACACACAGACAACTCGAGTTGTCTGTGTGTGTGTGTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172357    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173661.1-370s1c1
Sequence:CCGGCTGCAACTTCCTGGTGAGAATCTCGAGATTCTCACCAGGAAGTTGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168581    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173661.1-416s1c1
Sequence:CCGGGCACCTGCACTTCTAGTTATTCTCGAGAATAACTAGAAGTGCAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173661
LINC00955 MISSION shRNA shRNA Plasmid DNA
long intergenic non-protein coding RNA 955
Human
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000172440    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173661.1-598s1c1
Sequence:CCGGCACACACACACACACAGACAACTCGAGTTGTCTGTGTGTGTGTGTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172357    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173661.1-370s1c1
Sequence:CCGGCTGCAACTTCCTGGTGAGAATCTCGAGATTCTCACCAGGAAGTTGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168581    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173661.1-416s1c1
Sequence:CCGGGCACCTGCACTTCTAGTTATTCTCGAGAATAACTAGAAGTGCAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173661
LINC00955 MISSION shRNA Lentiviral Transduction Particles
long intergenic non-protein coding RNA 955
Human
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000172440    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173661.1-598s1c1
Sequence:CCGGCACACACACACACACAGACAACTCGAGTTGTCTGTGTGTGTGTGTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172357    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173661.1-370s1c1
Sequence:CCGGCTGCAACTTCCTGGTGAGAATCTCGAGATTCTCACCAGGAAGTTGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168581    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173661.1-416s1c1
Sequence:CCGGGCACCTGCACTTCTAGTTATTCTCGAGAATAACTAGAAGTGCAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks