EMAIL THIS PAGE TO A FRIEND

LIPG

lipase, endothelial

Synonyms: EDL EL PRO719
UniProtKB ID: Q9Y5X9, B0LPG6, Q6P9C8, Q6UW82
Gene ID:
Human(9388) Summary: The protein encoded by this gene has substantial phospholipase activity and may be involved in lipoprotein metabolism and vascular biology. This protein is designated a member of the TG lipase family by its sequence and characteristic lid region which provides substrate specificity for enzymes of the TG lipase family. [provided by RefSeq, Jul 2008]
Mouse(16891) lipase, endothelial
Rat(291437) lipase, endothelial
sheep(101111679) lipase, endothelial
Domestic Rabbit(100342293) lipase, endothelial
domestic guinea pig(100716001) lipase, endothelial
naked mole-rat(101720691) lipase, endothelial
Zebrafish(393096) lipase, endothelial
Horse(100053762) lipase, endothelial
domestic cat(101094139) lipase, endothelial
dog(609249) lipase, endothelial
chicken(426846) lipase, endothelial
136 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006033 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006033 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006033 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010720 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010720 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010720 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006033 Rosetta Predictions human pricing
NM_001012741 Rosetta Predictions rat pricing
NM_010720 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006033 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00132859 predicted 1317
2 SASI_Hs01_00132860 predicted 584
3 SASI_Hs01_00132861 predicted 384
4 SASI_Hs01_00132863 predicted 1529
5 SASI_Hs01_00132864 predicted 1517
6 SASI_Hs01_00132865 predicted 1357
7 SASI_Hs01_00132866 predicted 1327
8 SASI_Hs01_00132867 predicted 1036
9 SASI_Hs01_00132868 predicted 1017
10 SASI_Hs02_00340766 predicted 464
11 SASI_Hs01_00132862 predicted 601
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012741 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00066438 predicted 1184
2 SASI_Rn01_00066439 predicted 350
3 SASI_Rn01_00066440 predicted 943
4 SASI_Rn01_00066441 predicted 1062
5 SASI_Rn01_00066442 predicted 1044
6 SASI_Rn01_00066443 predicted 1269
7 SASI_Rn01_00066444 predicted 1234
8 SASI_Rn02_00200600 predicted 1211
9 SASI_Rn01_00066445 predicted 714
10 SASI_Rn01_00066446 predicted 1032
11 SASI_Rn01_00066447 predicted 1285
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010720 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00146925 predicted 1551
2 SASI_Mm01_00146926 predicted 1329
3 SASI_Mm01_00146927 predicted 1222
4 SASI_Mm01_00146928 predicted 1468
5 SASI_Mm01_00146929 predicted 626
6 SASI_Mm01_00146930 predicted 1620
7 SASI_Mm01_00146931 predicted 659
8 SASI_Mm01_00146932 predicted 1228
9 SASI_Mm01_00146933 predicted 1083
10 SASI_Mm01_00146934 predicted 1340
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006033
LIPG MISSION shRNA Bacterial Glycerol Stock
lipase, endothelial
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000378899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006033.2-782s21c1
Sequence:CCGGATGCAGGCAACTTCGTGAAAGCTCGAGCTTTCACGAAGTTGCCTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006033.2-642s21c1
Sequence:CCGGTTACACGGATGCGGTCAATAACTCGAGTTATTGACCGCATCCGTGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006033.2-1016s21c1
Sequence:CCGGACGATGTCTTGGGATCAATTGCTCGAGCAATTGATCCCAAGACATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006033.1-1194s1c1
Sequence:CCGGCCGTTGTAATAGCATTGGCTACTCGAGTAGCCAATGCTATTACAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006033.1-1359s1c1
Sequence:CCGGCGTCACCCTTTATGGCACTAACTCGAGTTAGTGCCATAAAGGGTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006033.1-1184s1c1
Sequence:CCGGGCCGCAAGAACCGTTGTAATACTCGAGTATTACAACGGTTCTTGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006033.1-927s1c1
Sequence:CCGGCTTCGGCTTGAGCATTGGTATCTCGAGATACCAATGCTCAAGCCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006033.1-468s1c1
Sequence:CCGGGCCCTTAGAAGACTGCAGTTTCTCGAGAAACTGCAGTCTTCTAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006033
LIPG MISSION shRNA shRNA Plasmid DNA
lipase, endothelial
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000378899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006033.2-782s21c1
Sequence:CCGGATGCAGGCAACTTCGTGAAAGCTCGAGCTTTCACGAAGTTGCCTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006033.2-642s21c1
Sequence:CCGGTTACACGGATGCGGTCAATAACTCGAGTTATTGACCGCATCCGTGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006033.2-1016s21c1
Sequence:CCGGACGATGTCTTGGGATCAATTGCTCGAGCAATTGATCCCAAGACATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006033.1-1194s1c1
Sequence:CCGGCCGTTGTAATAGCATTGGCTACTCGAGTAGCCAATGCTATTACAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006033.1-1359s1c1
Sequence:CCGGCGTCACCCTTTATGGCACTAACTCGAGTTAGTGCCATAAAGGGTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006033.1-1184s1c1
Sequence:CCGGGCCGCAAGAACCGTTGTAATACTCGAGTATTACAACGGTTCTTGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006033.1-927s1c1
Sequence:CCGGCTTCGGCTTGAGCATTGGTATCTCGAGATACCAATGCTCAAGCCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006033.1-468s1c1
Sequence:CCGGGCCCTTAGAAGACTGCAGTTTCTCGAGAAACTGCAGTCTTCTAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006033
LIPG MISSION shRNA Lentiviral Transduction Particles
lipase, endothelial
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000378899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006033.2-782s21c1
Sequence:CCGGATGCAGGCAACTTCGTGAAAGCTCGAGCTTTCACGAAGTTGCCTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006033.2-642s21c1
Sequence:CCGGTTACACGGATGCGGTCAATAACTCGAGTTATTGACCGCATCCGTGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006033.2-1016s21c1
Sequence:CCGGACGATGTCTTGGGATCAATTGCTCGAGCAATTGATCCCAAGACATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006033.1-1194s1c1
Sequence:CCGGCCGTTGTAATAGCATTGGCTACTCGAGTAGCCAATGCTATTACAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006033.1-1359s1c1
Sequence:CCGGCGTCACCCTTTATGGCACTAACTCGAGTTAGTGCCATAAAGGGTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006033.1-1184s1c1
Sequence:CCGGGCCGCAAGAACCGTTGTAATACTCGAGTATTACAACGGTTCTTGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006033.1-927s1c1
Sequence:CCGGCTTCGGCTTGAGCATTGGTATCTCGAGATACCAATGCTCAAGCCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006033.1-468s1c1
Sequence:CCGGGCCCTTAGAAGACTGCAGTTTCTCGAGAAACTGCAGTCTTCTAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010720
VALIDATED
LIPG MISSION shRNA Bacterial Glycerol Stock
lipase, endothelial
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000249108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010720.3-380s21c1
Sequence:CCGGCTGCGAGATGAGCATCATAAACTCGAGTTTATGATGCTCATCTCGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010720.3-813s21c1
Sequence:CCGGCTGGATACGCTGGCAACTTTGCTCGAGCAAAGTTGCCAGCGTATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249106    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010720.3-2930s21c1
Sequence:CCGGTTGCGTGTGTGCCGCCTAATTCTCGAGAATTAGGCGGCACACACGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010720.3-680s21c1
Sequence:CCGGTACACGGATGCAGTCAATAACCTCGAGGTTATTGACTGCATCCGTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010720.3-1220s21c1
Sequence:CCGGTGCCGGAAGAACCGTTGTAATCTCGAGATTACAACGGTTCTTCCGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178770    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010720.2-1076s1c1
Sequence:CCGGCCGGAAGAACCGTTGTAATAACTCGAGTTATTACAACGGTTCTTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195890    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010720.2-1364s1c1
Sequence:CCGGCGATCTCTTGAAGATGCGACTCTCGAGAGTCGCATCTTCAAGAGATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010720
VALIDATED
LIPG MISSION shRNA shRNA Plasmid DNA
lipase, endothelial
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000249108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010720.3-380s21c1
Sequence:CCGGCTGCGAGATGAGCATCATAAACTCGAGTTTATGATGCTCATCTCGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010720.3-813s21c1
Sequence:CCGGCTGGATACGCTGGCAACTTTGCTCGAGCAAAGTTGCCAGCGTATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249106    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010720.3-2930s21c1
Sequence:CCGGTTGCGTGTGTGCCGCCTAATTCTCGAGAATTAGGCGGCACACACGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010720.3-680s21c1
Sequence:CCGGTACACGGATGCAGTCAATAACCTCGAGGTTATTGACTGCATCCGTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010720.3-1220s21c1
Sequence:CCGGTGCCGGAAGAACCGTTGTAATCTCGAGATTACAACGGTTCTTCCGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178770    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010720.2-1076s1c1
Sequence:CCGGCCGGAAGAACCGTTGTAATAACTCGAGTTATTACAACGGTTCTTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195890    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010720.2-1364s1c1
Sequence:CCGGCGATCTCTTGAAGATGCGACTCTCGAGAGTCGCATCTTCAAGAGATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010720
VALIDATED
LIPG MISSION shRNA Lentiviral Transduction Particles
lipase, endothelial
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000249108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010720.3-380s21c1
Sequence:CCGGCTGCGAGATGAGCATCATAAACTCGAGTTTATGATGCTCATCTCGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010720.3-813s21c1
Sequence:CCGGCTGGATACGCTGGCAACTTTGCTCGAGCAAAGTTGCCAGCGTATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249106    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010720.3-2930s21c1
Sequence:CCGGTTGCGTGTGTGCCGCCTAATTCTCGAGAATTAGGCGGCACACACGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010720.3-680s21c1
Sequence:CCGGTACACGGATGCAGTCAATAACCTCGAGGTTATTGACTGCATCCGTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010720.3-1220s21c1
Sequence:CCGGTGCCGGAAGAACCGTTGTAATCTCGAGATTACAACGGTTCTTCCGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178770    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010720.2-1076s1c1
Sequence:CCGGCCGGAAGAACCGTTGTAATAACTCGAGTTATTACAACGGTTCTTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195890    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010720.2-1364s1c1
Sequence:CCGGCGATCTCTTGAAGATGCGACTCTCGAGAGTCGCATCTTCAAGAGATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks