EMAIL THIS PAGE TO A FRIEND

LIPJ

lipase, family member J

Synonyms: LIPL1 bA425M17.2
UniProtKB ID: Q5W064, A8MT98, Q0P671
Gene ID:
dog(477585) lipase, family member J
domestic cat(101098655) lipase, family member J
cow(515342) lipase, family member J
domestic guinea pig(100723939) lipase, family member J
naked mole-rat(101716677) lipase, family member J
sheep(101122743) lipase, family member J
19 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_084377 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_084377 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_084377 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU126211 MISSION® esiRNA esiRNA human LIPJ (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001010939 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001010939 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00070004 predicted 722
2 SASI_Hs01_00070005 predicted 738
3 SASI_Hs01_00070007 predicted 1116
4 SASI_Hs01_00070008 predicted 671
5 SASI_Hs01_00070009 predicted 578
6 SASI_Hs01_00070010 predicted 859
7 SASI_Hs01_00070012 predicted 583
8 SASI_Hs01_00070013 predicted 1218
9 SASI_Hs02_00305932 predicted 1208
10 SASI_Hs02_00305933 predicted 594
11 SASI_Hs01_00070006 predicted 414
12 SASI_Hs01_00070011 predicted 1160
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_084377
LIPJ MISSION shRNA Bacterial Glycerol Stock
lipase, family member J
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000050523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_084377.4-1152s1c1
Sequence:CCGGCCTGATCTGAACTTGGTTCATCTCGAGATGAACCAAGTTCAGATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_084377.4-381s1c1
Sequence:CCGGGATGGTTATATCCTTGGCCTTCTCGAGAAGGCCAAGGATATAACCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_084377.4-1288s1c1
Sequence:CCGGCTGAAATCACAAACCACATTTCTCGAGAAATGTGGTTTGTGATTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_084377.4-863s1c1
Sequence:CCGGGACATACAAATGGAAGTCAATCTCGAGATTGACTTCCATTTGTATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_084377.4-730s1c1
Sequence:CCGGGCCATTCACAGGGTACTACTACTCGAGTAGTAGTACCCTGTGAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_084377
LIPJ MISSION shRNA shRNA Plasmid DNA
lipase, family member J
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000050523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_084377.4-1152s1c1
Sequence:CCGGCCTGATCTGAACTTGGTTCATCTCGAGATGAACCAAGTTCAGATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_084377.4-381s1c1
Sequence:CCGGGATGGTTATATCCTTGGCCTTCTCGAGAAGGCCAAGGATATAACCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_084377.4-1288s1c1
Sequence:CCGGCTGAAATCACAAACCACATTTCTCGAGAAATGTGGTTTGTGATTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_084377.4-863s1c1
Sequence:CCGGGACATACAAATGGAAGTCAATCTCGAGATTGACTTCCATTTGTATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_084377.4-730s1c1
Sequence:CCGGGCCATTCACAGGGTACTACTACTCGAGTAGTAGTACCCTGTGAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_084377
LIPJ MISSION shRNA Lentiviral Transduction Particles
lipase, family member J
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000050523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_084377.4-1152s1c1
Sequence:CCGGCCTGATCTGAACTTGGTTCATCTCGAGATGAACCAAGTTCAGATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_084377.4-381s1c1
Sequence:CCGGGATGGTTATATCCTTGGCCTTCTCGAGAAGGCCAAGGATATAACCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_084377.4-1288s1c1
Sequence:CCGGCTGAAATCACAAACCACATTTCTCGAGAAATGTGGTTTGTGATTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_084377.4-863s1c1
Sequence:CCGGGACATACAAATGGAAGTCAATCTCGAGATTGACTTCCATTTGTATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_084377.4-730s1c1
Sequence:CCGGGCCATTCACAGGGTACTACTACTCGAGTAGTAGTACCCTGTGAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks