EMAIL THIS PAGE TO A FRIEND

LIX1

Lix1 homolog (chicken)

Synonyms: C5orf11
UniProtKB ID: Q8N485, A8K4R9, Q8N7I2
Gene ID:
Mouse(66643) limb expression 1 homolog (chicken)
Rat(292381) Lix1 homolog (chicken)
Zebrafish(558010) Lix1 homolog (chicken)
domestic cat(751823) Lix1 homolog (chicken)
cow(535033) Lix1 homolog (chicken)
dog(488894) Lix1 homolog (chicken)
chicken(374264) Lix1 homolog
domestic guinea pig(100723327) Lix1 homolog (chicken)
naked mole-rat(101710285) Lix1 homolog (chicken)
sheep(101111019) Lix1 homolog (chicken)
115 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153234 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153234 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153234 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025681 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025681 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025681 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153234 Rosetta Predictions human pricing
NM_001106214 Rosetta Predictions rat pricing
NM_025681 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153234 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00367098 predicted 252
2 SASI_Hs01_00091505 predicted 296
3 SASI_Hs01_00091506 predicted 516
4 SASI_Hs02_00367099 predicted 816
5 SASI_Hs01_00091508 predicted 809
6 SASI_Hs01_00091509 predicted 575
7 SASI_Hs01_00091510 predicted 473
8 SASI_Hs01_00091511 predicted 798
9 SASI_Hs01_00091512 predicted 327
10 SASI_Hs02_00367100 predicted 318
11 SASI_Hs01_00091507 predicted 666
12 SASI_Hs01_00091513 predicted 242
13 SASI_Hs01_00091514 predicted 461
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106214 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00216758 predicted 762
2 SASI_Rn02_00216759 predicted 776
3 SASI_Rn02_00216760 predicted 623
4 SASI_Rn02_00216761 predicted 782
5 SASI_Rn02_00216762 predicted 929
6 SASI_Rn02_00216763 predicted 842
7 SASI_Rn02_00216764 predicted 439
8 SASI_Rn02_00216765 predicted 937
9 SASI_Rn02_00216766 predicted 707
10 SASI_Rn02_00216767 predicted 822
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025681 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00197053 predicted 440
2 SASI_Mm01_00197055 predicted 607
3 SASI_Mm01_00197056 predicted 537
4 SASI_Mm01_00197057 predicted 488
5 SASI_Mm02_00328826 predicted 579
6 SASI_Mm02_00328827 predicted 667
7 SASI_Mm02_00328828 predicted 272
8 SASI_Mm01_00197058 predicted 555
9 SASI_Mm01_00197059 predicted 684
10 SASI_Mm01_00197060 predicted 415
11 SASI_Mm01_00197054 predicted 415
12 SASI_Mm01_00197061 predicted 414
13 SASI_Mm01_00197062 predicted 421
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153234
LIX1 MISSION shRNA Bacterial Glycerol Stock
Lix1 homolog (chicken)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000148070    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153234.3-3093s1c1
Sequence:CCGGGCACCCATTCTGTAAATTGAACTCGAGTTCAATTTACAGAATGGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147491    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153234.3-3468s1c1
Sequence:CCGGGCCCTTTGAGAATCTGATAAACTCGAGTTTATCAGATTCTCAAAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147388    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153234.3-1946s1c1
Sequence:CCGGGCTCTGTTTGTTGTTCAAGAACTCGAGTTCTTGAACAACAAACAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000131035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153234.3-354s1c1
Sequence:CCGGCTTTGTGAGTTACGTGACCCTCTCGAGAGGGTCACGTAACTCACAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129257    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153234.3-3003s1c1
Sequence:CCGGCCTCAAACTGACACCATCTTACTCGAGTAAGATGGTGTCAGTTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129557    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153234.3-697s1c1
Sequence:CCGGCGTGAAACAAAGTGTTCCCGACTCGAGTCGGGAACACTTTGTTTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153234.3-229s1c1
Sequence:CCGGGTCTTCAAAGACTTGAACGTTCTCGAGAACGTTCAAGTCTTTGAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153234.4-901s21c1
Sequence:CCGGGTCTCTCAAGAGCTACGAATGCTCGAGCATTCGTAGCTCTTGAGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413436    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153234.4-1121s21c1
Sequence:CCGGGCAGAGGCCAGATTAACATTACTCGAGTAATGTTAATCTGGCCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412455    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153234.4-1466s21c1
Sequence:CCGGTTAGGTGAAGTAGCATGATAGCTCGAGCTATCATGCTACTTCACCTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153234
LIX1 MISSION shRNA shRNA Plasmid DNA
Lix1 homolog (chicken)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000148070    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153234.3-3093s1c1
Sequence:CCGGGCACCCATTCTGTAAATTGAACTCGAGTTCAATTTACAGAATGGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147491    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153234.3-3468s1c1
Sequence:CCGGGCCCTTTGAGAATCTGATAAACTCGAGTTTATCAGATTCTCAAAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147388    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153234.3-1946s1c1
Sequence:CCGGGCTCTGTTTGTTGTTCAAGAACTCGAGTTCTTGAACAACAAACAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000131035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153234.3-354s1c1
Sequence:CCGGCTTTGTGAGTTACGTGACCCTCTCGAGAGGGTCACGTAACTCACAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129257    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153234.3-3003s1c1
Sequence:CCGGCCTCAAACTGACACCATCTTACTCGAGTAAGATGGTGTCAGTTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129557    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153234.3-697s1c1
Sequence:CCGGCGTGAAACAAAGTGTTCCCGACTCGAGTCGGGAACACTTTGTTTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153234.3-229s1c1
Sequence:CCGGGTCTTCAAAGACTTGAACGTTCTCGAGAACGTTCAAGTCTTTGAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153234.4-901s21c1
Sequence:CCGGGTCTCTCAAGAGCTACGAATGCTCGAGCATTCGTAGCTCTTGAGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413436    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153234.4-1121s21c1
Sequence:CCGGGCAGAGGCCAGATTAACATTACTCGAGTAATGTTAATCTGGCCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412455    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153234.4-1466s21c1
Sequence:CCGGTTAGGTGAAGTAGCATGATAGCTCGAGCTATCATGCTACTTCACCTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153234
LIX1 MISSION shRNA Lentiviral Transduction Particles
Lix1 homolog (chicken)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000148070    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153234.3-3093s1c1
Sequence:CCGGGCACCCATTCTGTAAATTGAACTCGAGTTCAATTTACAGAATGGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147491    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153234.3-3468s1c1
Sequence:CCGGGCCCTTTGAGAATCTGATAAACTCGAGTTTATCAGATTCTCAAAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147388    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153234.3-1946s1c1
Sequence:CCGGGCTCTGTTTGTTGTTCAAGAACTCGAGTTCTTGAACAACAAACAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000131035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153234.3-354s1c1
Sequence:CCGGCTTTGTGAGTTACGTGACCCTCTCGAGAGGGTCACGTAACTCACAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129257    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153234.3-3003s1c1
Sequence:CCGGCCTCAAACTGACACCATCTTACTCGAGTAAGATGGTGTCAGTTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129557    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153234.3-697s1c1
Sequence:CCGGCGTGAAACAAAGTGTTCCCGACTCGAGTCGGGAACACTTTGTTTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153234.3-229s1c1
Sequence:CCGGGTCTTCAAAGACTTGAACGTTCTCGAGAACGTTCAAGTCTTTGAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153234.4-901s21c1
Sequence:CCGGGTCTCTCAAGAGCTACGAATGCTCGAGCATTCGTAGCTCTTGAGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413436    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153234.4-1121s21c1
Sequence:CCGGGCAGAGGCCAGATTAACATTACTCGAGTAATGTTAATCTGGCCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412455    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153234.4-1466s21c1
Sequence:CCGGTTAGGTGAAGTAGCATGATAGCTCGAGCTATCATGCTACTTCACCTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025681
LIX1 MISSION shRNA Bacterial Glycerol Stock
Lix1 homolog (chicken)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025681.1-616s1c1
Sequence:CCGGCGTGAAACAAAGTGCTCTCGACTCGAGTCGAGAGCACTTTGTTTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025681.1-909s1c1
Sequence:CCGGCTGTGTGGCTATCATTAGCAACTCGAGTTGCTAATGATAGCCACACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025681.1-166s1c1
Sequence:CCGGGTTGTGTCAATGTTACAGGAACTCGAGTTCCTGTAACATTGACACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192725    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025681.1-953s1c1
Sequence:CCGGGACGTTCACATCAGGAATCTACTCGAGTAGATTCCTGATGTGAACGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200617    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025681.1-975s1c1
Sequence:CCGGCTGACAGAAGTTGTTAGAGATCTCGAGATCTCTAACAACTTCTGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025681
LIX1 MISSION shRNA shRNA Plasmid DNA
Lix1 homolog (chicken)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025681.1-616s1c1
Sequence:CCGGCGTGAAACAAAGTGCTCTCGACTCGAGTCGAGAGCACTTTGTTTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025681.1-909s1c1
Sequence:CCGGCTGTGTGGCTATCATTAGCAACTCGAGTTGCTAATGATAGCCACACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025681.1-166s1c1
Sequence:CCGGGTTGTGTCAATGTTACAGGAACTCGAGTTCCTGTAACATTGACACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192725    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025681.1-953s1c1
Sequence:CCGGGACGTTCACATCAGGAATCTACTCGAGTAGATTCCTGATGTGAACGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200617    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025681.1-975s1c1
Sequence:CCGGCTGACAGAAGTTGTTAGAGATCTCGAGATCTCTAACAACTTCTGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025681
LIX1 MISSION shRNA Lentiviral Transduction Particles
Lix1 homolog (chicken)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025681.1-616s1c1
Sequence:CCGGCGTGAAACAAAGTGCTCTCGACTCGAGTCGAGAGCACTTTGTTTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025681.1-909s1c1
Sequence:CCGGCTGTGTGGCTATCATTAGCAACTCGAGTTGCTAATGATAGCCACACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025681.1-166s1c1
Sequence:CCGGGTTGTGTCAATGTTACAGGAACTCGAGTTCCTGTAACATTGACACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192725    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025681.1-953s1c1
Sequence:CCGGGACGTTCACATCAGGAATCTACTCGAGTAGATTCCTGATGTGAACGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200617    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025681.1-975s1c1
Sequence:CCGGCTGACAGAAGTTGTTAGAGATCTCGAGATCTCTAACAACTTCTGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks