EMAIL THIS PAGE TO A FRIEND

LIX1L

Lix1 homolog (mouse)-like

UniProtKB ID: Q8IVB5, Q6AI36
Gene ID:
Mouse(280411) Lix1-like
Rat(499677) Lix1 homolog (mouse)-like
sheep(101118146) Lix1 homolog (mouse)-like
domestic guinea pig(100731975) Lix1 homolog (mouse)-like
naked mole-rat(101702337) Lix1 homolog (mouse)-like
Zebrafish(572161) Lix1 homolog (mouse)-like
cow(788858) Lix1 homolog (mouse)-like
domestic cat(101086916) Lix1 homolog (mouse)-like
dog(608332) Lix1 homolog (mouse)-like
69 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153713 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153713 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153713 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153713 Rosetta Predictions human pricing
NM_001024303 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153713 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00118008 predicted 696
2 SASI_Hs01_00118009 predicted 469
3 SASI_Hs01_00118011 predicted 718
4 SASI_Hs01_00118012 predicted 1048
5 SASI_Hs01_00118013 predicted 890
6 SASI_Hs01_00118014 predicted 791
7 SASI_Hs02_00367441 predicted 504
8 SASI_Hs01_00118015 predicted 574
9 SASI_Hs01_00118016 predicted 787
10 SASI_Hs01_00118017 predicted 1061
11 SASI_Hs01_00118010 predicted 1113
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024303 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00032194 predicted 1336
2 SASI_Rn01_00032195 predicted 571
3 SASI_Rn01_00032196 predicted 894
4 SASI_Rn01_00032197 predicted 811
5 SASI_Rn01_00032198 predicted 963
6 SASI_Rn01_00032199 predicted 715
7 SASI_Rn01_00032200 predicted 1367
8 SASI_Rn01_00032201 predicted 1348
9 SASI_Rn01_00032203 predicted 573
10 SASI_Rn02_00202500 predicted 1227
11 SASI_Rn01_00032202 predicted 1356
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153713
VALIDATED
LIX1L MISSION shRNA Bacterial Glycerol Stock
Lix1 homolog (mouse)-like
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000297578    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_153713.1-1230s21c1
Sequence:CCGGCCTATTTGCTAAGAGATCCCTCTCGAGAGGGATCTCTTAGCAAATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_153713.1-600s21c1
Sequence:CCGGGAACATCCTTCCCGAAGAATCCTCGAGGATTCTTCGGGAAGGATGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278863    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_153713.1-563s21c1
Sequence:CCGGTGCTGCAAAGATTGCGCTAATCTCGAGATTAGCGCAATCTTTGCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_153713.1-729s21c1
Sequence:CCGGCTGGAATCCAACAAGGGCAAACTCGAGTTTGCCCTTGTTGGATTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_153713.1-715s21c1
Sequence:CCGGCCTTCCGATTCATGCTGGAATCTCGAGATTCCAGCATGAATCGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_153713.1-715s1c1
Sequence:CCGGCCTTCCGATTCATGCTGGAATCTCGAGATTCCAGCATGAATCGGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135165    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_153713.1-1230s1c1
Sequence:CCGGCCTATTTGCTAAGAGATCCCTCTCGAGAGGGATCTCTTAGCAAATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133809    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_153713.1-1303s1c1
Sequence:CCGGCTTTACAACAAAGAGCAGCTTCTCGAGAAGCTGCTCTTTGTTGTAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133925    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153713.1-1016s1c1
Sequence:CCGGCCACAAGGAGAAGAAAGATATCTCGAGATATCTTTCTTCTCCTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153713.1-690s1c1
Sequence:CCGGGACAACCCAAATACAGGGATTCTCGAGAATCCCTGTATTTGGGTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138532    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153713.1-719s1c1
Sequence:CCGGCCGATTCATGCTGGAATCCAACTCGAGTTGGATTCCAGCATGAATCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138328    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_153713.1-729s1c1
Sequence:CCGGCTGGAATCCAACAAGGGCAAACTCGAGTTTGCCCTTGTTGGATTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138080    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153713.1-1317s1c1
Sequence:CCGGGCAGCTTGTCTTTGCAGCTTTCTCGAGAAAGCTGCAAAGACAAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153713
VALIDATED
LIX1L MISSION shRNA shRNA Plasmid DNA
Lix1 homolog (mouse)-like
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000297578    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_153713.1-1230s21c1
Sequence:CCGGCCTATTTGCTAAGAGATCCCTCTCGAGAGGGATCTCTTAGCAAATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_153713.1-600s21c1
Sequence:CCGGGAACATCCTTCCCGAAGAATCCTCGAGGATTCTTCGGGAAGGATGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278863    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_153713.1-563s21c1
Sequence:CCGGTGCTGCAAAGATTGCGCTAATCTCGAGATTAGCGCAATCTTTGCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_153713.1-729s21c1
Sequence:CCGGCTGGAATCCAACAAGGGCAAACTCGAGTTTGCCCTTGTTGGATTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_153713.1-715s21c1
Sequence:CCGGCCTTCCGATTCATGCTGGAATCTCGAGATTCCAGCATGAATCGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_153713.1-715s1c1
Sequence:CCGGCCTTCCGATTCATGCTGGAATCTCGAGATTCCAGCATGAATCGGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135165    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_153713.1-1230s1c1
Sequence:CCGGCCTATTTGCTAAGAGATCCCTCTCGAGAGGGATCTCTTAGCAAATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133809    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_153713.1-1303s1c1
Sequence:CCGGCTTTACAACAAAGAGCAGCTTCTCGAGAAGCTGCTCTTTGTTGTAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133925    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153713.1-1016s1c1
Sequence:CCGGCCACAAGGAGAAGAAAGATATCTCGAGATATCTTTCTTCTCCTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153713.1-690s1c1
Sequence:CCGGGACAACCCAAATACAGGGATTCTCGAGAATCCCTGTATTTGGGTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138532    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153713.1-719s1c1
Sequence:CCGGCCGATTCATGCTGGAATCCAACTCGAGTTGGATTCCAGCATGAATCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138328    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_153713.1-729s1c1
Sequence:CCGGCTGGAATCCAACAAGGGCAAACTCGAGTTTGCCCTTGTTGGATTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138080    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153713.1-1317s1c1
Sequence:CCGGGCAGCTTGTCTTTGCAGCTTTCTCGAGAAAGCTGCAAAGACAAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153713
VALIDATED
LIX1L MISSION shRNA Lentiviral Transduction Particles
Lix1 homolog (mouse)-like
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000297578    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_153713.1-1230s21c1
Sequence:CCGGCCTATTTGCTAAGAGATCCCTCTCGAGAGGGATCTCTTAGCAAATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_153713.1-600s21c1
Sequence:CCGGGAACATCCTTCCCGAAGAATCCTCGAGGATTCTTCGGGAAGGATGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278863    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_153713.1-563s21c1
Sequence:CCGGTGCTGCAAAGATTGCGCTAATCTCGAGATTAGCGCAATCTTTGCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_153713.1-729s21c1
Sequence:CCGGCTGGAATCCAACAAGGGCAAACTCGAGTTTGCCCTTGTTGGATTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_153713.1-715s21c1
Sequence:CCGGCCTTCCGATTCATGCTGGAATCTCGAGATTCCAGCATGAATCGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_153713.1-715s1c1
Sequence:CCGGCCTTCCGATTCATGCTGGAATCTCGAGATTCCAGCATGAATCGGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135165    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_153713.1-1230s1c1
Sequence:CCGGCCTATTTGCTAAGAGATCCCTCTCGAGAGGGATCTCTTAGCAAATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133809    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_153713.1-1303s1c1
Sequence:CCGGCTTTACAACAAAGAGCAGCTTCTCGAGAAGCTGCTCTTTGTTGTAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133925    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153713.1-1016s1c1
Sequence:CCGGCCACAAGGAGAAGAAAGATATCTCGAGATATCTTTCTTCTCCTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153713.1-690s1c1
Sequence:CCGGGACAACCCAAATACAGGGATTCTCGAGAATCCCTGTATTTGGGTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138532    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153713.1-719s1c1
Sequence:CCGGCCGATTCATGCTGGAATCCAACTCGAGTTGGATTCCAGCATGAATCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138328    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_153713.1-729s1c1
Sequence:CCGGCTGGAATCCAACAAGGGCAAACTCGAGTTTGCCCTTGTTGGATTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138080    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153713.1-1317s1c1
Sequence:CCGGGCAGCTTGTCTTTGCAGCTTTCTCGAGAAAGCTGCAAAGACAAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks