EMAIL THIS PAGE TO A FRIEND

LLGL1

lethal giant larvae homolog 1 (Drosophila)

Synonyms: DLG4 HUGL HUGL-1 HUGL1 LLGL
UniProtKB ID: Q15334, A7MBM7, O00188, Q58F11, Q86UK6
Gene ID:
Human(3996) Summary: This gene encodes a protein that is similar to a tumor suppressor in Drosophila. The protein is part of a cytoskeletal network and is associated with nonmuscle myosin II heavy chain and a kinase that specifically phosphorylates this protein at serine residues. The gene is located within the Smith-Magenis syndrome region on chromosome 17. [provided by RefSeq, Jul 2008]
Mouse(16897) lethal giant larvae homolog 1 (Drosophila)
Rat(54265) lethal giant larvae homolog 1 (Drosophila)
Zebrafish(751760) lethal giant larvae homolog 1 (Drosophila)
cow(281901) lethal giant larvae homolog
cow(781865) lethal giant larvae homolog 1 (Drosophila)
Horse(100051856) lethal giant larvae homolog 1 (Drosophila)
Horse(100061544) lethal giant larvae homolog 1 (Drosophila)
domestic cat(101086763) lethal giant larvae homolog 1 (Drosophila)
dog(489538) lethal giant larvae homolog 1 (Drosophila)
chicken(100858027) lethal giant larvae homolog 1 (Drosophila)
sheep(101120930) lethal giant larvae homolog 1 (Drosophila)
Domestic Rabbit(100339587) lethal giant larvae homolog 1 (Drosophila)
domestic guinea pig(100728315) lethal giant larvae homolog 1 (Drosophila)
naked mole-rat(101698973) lethal giant larvae homolog 1 (Drosophila)
115 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004140 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004140 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004140 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008502 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008502 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008502 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU146461 MISSION® esiRNA esiRNA human LLGL1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004140 Rosetta Predictions human pricing
NM_152844 Rosetta Predictions rat pricing
NM_008502 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004140 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00043909 predicted 832
2 SASI_Hs01_00043910 predicted 936
3 SASI_Hs01_00043911 predicted 2930
4 SASI_Hs01_00043912 predicted 2229
5 SASI_Hs01_00043913 predicted 2840
6 SASI_Hs01_00043914 predicted 2774
7 SASI_Hs01_00043915 predicted 1021
8 SASI_Hs01_00043916 predicted 2860
9 SASI_Hs01_00043917 predicted 2081
10 SASI_Hs01_00043918 predicted 3333
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152844 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00268906 predicted 736
2 SASI_Rn01_00081640 predicted 2771
3 SASI_Rn02_00268907 predicted 2514
4 SASI_Rn01_00081641 predicted 297
5 SASI_Rn01_00081642 predicted 2822
6 SASI_Rn01_00081643 predicted 308
7 SASI_Rn01_00081645 predicted 2715
8 SASI_Rn02_00268908 predicted 263
9 SASI_Rn01_00081647 predicted 277
10 SASI_Rn01_00081648 predicted 2581
11 SASI_Rn01_00081644 predicted 997
12 SASI_Rn01_00081646 predicted 1800
13 SASI_Rn01_00081649 predicted 1428
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008502 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00177664 predicted 2779
2 SASI_Mm01_00177665 predicted 2582
3 SASI_Mm01_00177666 predicted 3054
4 SASI_Mm01_00177667 predicted 2171
5 SASI_Mm01_00177668 predicted 3091
6 SASI_Mm01_00177669 predicted 1526
7 SASI_Mm02_00314057 predicted 2714
8 SASI_Mm01_00177671 predicted 2732
9 SASI_Mm01_00177672 predicted 490
10 SASI_Mm01_00177673 predicted 887
11 SASI_Mm01_00177670 predicted 2919
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004140
LLGL1 MISSION shRNA Bacterial Glycerol Stock
lethal giant larvae homolog 1 (Drosophila)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000117137    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004140.3-3567s1c1
Sequence:CCGGCCCTCACTTTGCAGAGTATTTCTCGAGAAATACTCTGCAAAGTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004140.3-2235s1c1
Sequence:CCGGGCCTATACTTTGCCGACACATCTCGAGATGTGTCGGCAAAGTATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004140.3-684s1c1
Sequence:CCGGCCACAAAGATTCTCATTGGCTCTCGAGAGCCAATGAGAATCTTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004140.3-365s1c1
Sequence:CCGGTGGGAGATTGTCCACCATAATCTCGAGATTATGGTGGACAATCTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004140.3-2845s1c1
Sequence:CCGGCCCATCAGAATTTGAACGCTTCTCGAGAAGCGTTCAAATTCTGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004140.3-1064s21c1
Sequence:CCGGGACTTCACTTCCCGCATCATCCTCGAGGATGATGCGGGAAGTGAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004140.3-924s21c1
Sequence:CCGGGCAAGGCCATTAACAAGATTCCTCGAGGAATCTTGTTAATGGCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004140.3-1618s21c1
Sequence:CCGGGGTTGCTCTCTGCAAGTATACCTCGAGGTATACTTGCAGAGAGCAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004140
LLGL1 MISSION shRNA shRNA Plasmid DNA
lethal giant larvae homolog 1 (Drosophila)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000117137    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004140.3-3567s1c1
Sequence:CCGGCCCTCACTTTGCAGAGTATTTCTCGAGAAATACTCTGCAAAGTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004140.3-2235s1c1
Sequence:CCGGGCCTATACTTTGCCGACACATCTCGAGATGTGTCGGCAAAGTATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004140.3-684s1c1
Sequence:CCGGCCACAAAGATTCTCATTGGCTCTCGAGAGCCAATGAGAATCTTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004140.3-365s1c1
Sequence:CCGGTGGGAGATTGTCCACCATAATCTCGAGATTATGGTGGACAATCTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004140.3-2845s1c1
Sequence:CCGGCCCATCAGAATTTGAACGCTTCTCGAGAAGCGTTCAAATTCTGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004140.3-1064s21c1
Sequence:CCGGGACTTCACTTCCCGCATCATCCTCGAGGATGATGCGGGAAGTGAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004140.3-924s21c1
Sequence:CCGGGCAAGGCCATTAACAAGATTCCTCGAGGAATCTTGTTAATGGCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004140.3-1618s21c1
Sequence:CCGGGGTTGCTCTCTGCAAGTATACCTCGAGGTATACTTGCAGAGAGCAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004140
LLGL1 MISSION shRNA Lentiviral Transduction Particles
lethal giant larvae homolog 1 (Drosophila)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000117137    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004140.3-3567s1c1
Sequence:CCGGCCCTCACTTTGCAGAGTATTTCTCGAGAAATACTCTGCAAAGTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004140.3-2235s1c1
Sequence:CCGGGCCTATACTTTGCCGACACATCTCGAGATGTGTCGGCAAAGTATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004140.3-684s1c1
Sequence:CCGGCCACAAAGATTCTCATTGGCTCTCGAGAGCCAATGAGAATCTTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004140.3-365s1c1
Sequence:CCGGTGGGAGATTGTCCACCATAATCTCGAGATTATGGTGGACAATCTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004140.3-2845s1c1
Sequence:CCGGCCCATCAGAATTTGAACGCTTCTCGAGAAGCGTTCAAATTCTGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004140.3-1064s21c1
Sequence:CCGGGACTTCACTTCCCGCATCATCCTCGAGGATGATGCGGGAAGTGAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004140.3-924s21c1
Sequence:CCGGGCAAGGCCATTAACAAGATTCCTCGAGGAATCTTGTTAATGGCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004140.3-1618s21c1
Sequence:CCGGGGTTGCTCTCTGCAAGTATACCTCGAGGTATACTTGCAGAGAGCAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008502
VALIDATED
LLGL1 MISSION shRNA Bacterial Glycerol Stock
lethal giant larvae homolog 1 (Drosophila)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000088338    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008502.1-3997s1c1
Sequence:CCGGCCAGTCATTCTAAAGCAGTTTCTCGAGAAACTGCTTTAGAATGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008502.1-3096s1c1
Sequence:CCGGCGTGGAATATGTGAAGGATTTCTCGAGAAATCCTTCACATATTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008502.1-2528s1c1
Sequence:CCGGCCAAGGTGAGTGCTAAGACTACTCGAGTAGTCTTAGCACTCACCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008502.1-2846s1c1
Sequence:CCGGCACTATGTTCTCTGGATATAACTCGAGTTATATCCAGAGAACATAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008502.1-324s1c1
Sequence:CCGGCTGGGAGATCATCCATCATAACTCGAGTTATGATGGATGATCTCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008502.2-2678s21c1
Sequence:CCGGCCAAGGTGAGTGCTAAGACTACTCGAGTAGTCTTAGCACTCACCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008502.2-2996s21c1
Sequence:CCGGCACTATGTTCTCTGGATATAACTCGAGTTATATCCAGAGAACATAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008502.2-3246s21c1
Sequence:CCGGCGTGGAATATGTGAAGGATTTCTCGAGAAATCCTTCACATATTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008502.2-3180s21c1
Sequence:CCGGCTCGCCTGTGTCCATTGATTCCTCGAGGAATCAATGGACACAGGCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305158    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008502.2-3418s21c1
Sequence:CCGGGCCTACACCCTTCTGATTAAACTCGAGTTTAATCAGAAGGGTGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008502
VALIDATED
LLGL1 MISSION shRNA shRNA Plasmid DNA
lethal giant larvae homolog 1 (Drosophila)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000088338    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008502.1-3997s1c1
Sequence:CCGGCCAGTCATTCTAAAGCAGTTTCTCGAGAAACTGCTTTAGAATGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008502.1-3096s1c1
Sequence:CCGGCGTGGAATATGTGAAGGATTTCTCGAGAAATCCTTCACATATTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008502.1-2528s1c1
Sequence:CCGGCCAAGGTGAGTGCTAAGACTACTCGAGTAGTCTTAGCACTCACCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008502.1-2846s1c1
Sequence:CCGGCACTATGTTCTCTGGATATAACTCGAGTTATATCCAGAGAACATAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008502.1-324s1c1
Sequence:CCGGCTGGGAGATCATCCATCATAACTCGAGTTATGATGGATGATCTCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008502.2-2678s21c1
Sequence:CCGGCCAAGGTGAGTGCTAAGACTACTCGAGTAGTCTTAGCACTCACCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008502.2-2996s21c1
Sequence:CCGGCACTATGTTCTCTGGATATAACTCGAGTTATATCCAGAGAACATAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008502.2-3246s21c1
Sequence:CCGGCGTGGAATATGTGAAGGATTTCTCGAGAAATCCTTCACATATTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008502.2-3180s21c1
Sequence:CCGGCTCGCCTGTGTCCATTGATTCCTCGAGGAATCAATGGACACAGGCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305158    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008502.2-3418s21c1
Sequence:CCGGGCCTACACCCTTCTGATTAAACTCGAGTTTAATCAGAAGGGTGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008502
VALIDATED
LLGL1 MISSION shRNA Lentiviral Transduction Particles
lethal giant larvae homolog 1 (Drosophila)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000088338    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008502.1-3997s1c1
Sequence:CCGGCCAGTCATTCTAAAGCAGTTTCTCGAGAAACTGCTTTAGAATGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008502.1-3096s1c1
Sequence:CCGGCGTGGAATATGTGAAGGATTTCTCGAGAAATCCTTCACATATTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008502.1-2528s1c1
Sequence:CCGGCCAAGGTGAGTGCTAAGACTACTCGAGTAGTCTTAGCACTCACCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008502.1-2846s1c1
Sequence:CCGGCACTATGTTCTCTGGATATAACTCGAGTTATATCCAGAGAACATAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008502.1-324s1c1
Sequence:CCGGCTGGGAGATCATCCATCATAACTCGAGTTATGATGGATGATCTCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008502.2-2678s21c1
Sequence:CCGGCCAAGGTGAGTGCTAAGACTACTCGAGTAGTCTTAGCACTCACCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008502.2-2996s21c1
Sequence:CCGGCACTATGTTCTCTGGATATAACTCGAGTTATATCCAGAGAACATAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008502.2-3246s21c1
Sequence:CCGGCGTGGAATATGTGAAGGATTTCTCGAGAAATCCTTCACATATTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008502.2-3180s21c1
Sequence:CCGGCTCGCCTGTGTCCATTGATTCCTCGAGGAATCAATGGACACAGGCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305158    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008502.2-3418s21c1
Sequence:CCGGGCCTACACCCTTCTGATTAAACTCGAGTTTAATCAGAAGGGTGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks