EMAIL THIS PAGE TO A FRIEND

LLGL2

lethal giant larvae homolog 2 (Drosophila)

Synonyms: HGL LGL2
UniProtKB ID: Q6P1M3, Q14521, Q9BR62
Gene ID:
Human(3993) Summary: The lethal (2) giant larvae protein of Drosophila plays a role in asymmetric cell division, epithelial cell polarity, and cell migration. This human gene encodes a protein similar to lethal (2) giant larvae of Drosophila. In fly, the protein's ability to localize cell fate determinants is regulated by the atypical protein kinase C (aPKC). In human, this protein interacts with aPKC-containing complexes and is cortically localized in mitotic cells. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Mouse(217325) lethal giant larvae homolog 2 (Drosophila)
Rat(360661) lethal giant larvae homolog 2 (Drosophila)
domestic guinea pig(100717035) lethal giant larvae homolog 2 (Drosophila)
naked mole-rat(101721668) lethal giant larvae homolog 2 (Drosophila)
sheep(101120426) lethal giant larvae homolog 2 (Drosophila)
Zebrafish(795670) lethal giant larvae homolog 2 (Drosophila)
chicken(422127) lethal giant larvae homolog 2 (Drosophila)
cow(539545) lethal giant larvae homolog 2 (Drosophila)
domestic cat(101100607) lethal giant larvae homolog 2 (Drosophila)
dog(609568) lethal giant larvae homolog 2 (Drosophila)
96 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145438 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145438 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145438 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004524 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004524 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004524 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU048261 MISSION® esiRNA esiRNA human LLGL2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001015002 Rosetta Predictions human pricing
NM_001031803 Rosetta Predictions human pricing
NM_004524 Rosetta Predictions human pricing
NM_001127549 Rosetta Predictions rat pricing
NM_145438 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001015002 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00224253 predicted 441
2 SASI_Hs01_00224254 predicted 577
3 SASI_Hs01_00224255 predicted 601
4 SASI_Hs01_00224256 predicted 887
5 SASI_Hs01_00224257 predicted 756
6 SASI_Hs01_00224258 predicted 785
7 SASI_Hs01_00224259 predicted 964
8 SASI_Hs01_00224260 predicted 440
9 SASI_Hs02_00306636 predicted 926
10 SASI_Hs01_00224261 predicted 491
11 SASI_Hs01_00224262 predicted 605
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001031803 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00057023 predicted 439
2 SASI_Hs01_00057024 predicted 582
3 SASI_Hs01_00057025 predicted 602
4 SASI_Hs01_00057026 predicted 896
5 SASI_Hs01_00057027 predicted 755
6 SASI_Hs01_00057028 predicted 785
7 SASI_Hs01_00057029 predicted 969
8 SASI_Hs01_00057030 predicted 439
9 SASI_Hs02_00307817 predicted 929
10 SASI_Hs01_00057031 predicted 488
11 SASI_Hs01_00057032 predicted 608
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004524 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00228364 predicted 447
2 SASI_Hs01_00228365 predicted 582
3 SASI_Hs01_00228366 predicted 594
4 SASI_Hs01_00228367 predicted 888
5 SASI_Hs01_00228368 predicted 751
6 SASI_Hs01_00228369 predicted 789
7 SASI_Hs01_00228370 predicted 963
8 SASI_Hs01_00228371 predicted 439
9 SASI_Hs02_00337817 predicted 926
10 SASI_Hs01_00228372 predicted 492
11 SASI_Hs01_00228373 predicted 601
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127549 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00254243 predicted 890
2 SASI_Rn02_00254244 predicted 2770
3 SASI_Rn02_00254245 predicted 391
4 SASI_Rn02_00254246 predicted 2886
5 SASI_Rn02_00254247 predicted 2862
6 SASI_Rn02_00254248 predicted 1534
7 SASI_Rn02_00254249 predicted 1887
8 SASI_Rn02_00254250 predicted 1320
9 SASI_Rn02_00254251 predicted 774
10 SASI_Rn02_00254252 predicted 3190
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145438 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00104199 predicted 1870
2 SASI_Mm01_00104200 predicted 2867
3 SASI_Mm01_00104201 predicted 978
4 SASI_Mm01_00104202 predicted 2877
5 SASI_Mm01_00104203 predicted 3051
6 SASI_Mm01_00104204 predicted 3214
7 SASI_Mm02_00340816 predicted 2306
8 SASI_Mm01_00104206 predicted 3104
9 SASI_Mm02_00340817 predicted 479
10 SASI_Mm01_00104208 predicted 1509
11 SASI_Mm01_00104205 predicted 336
12 SASI_Mm01_00104207 predicted 828
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145438
VALIDATED
LLGL2 MISSION shRNA Bacterial Glycerol Stock
lethal giant larvae homolog 2 (Drosophila)
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000087878    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145438.1-3203s1c1
Sequence:CCGGCTGTGGGATGATCACACACTACTCGAGTAGTGTGTGATCATCCCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087882    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145438.1-2078s1c1
Sequence:CCGGCAGCAGAGTGTCCAGTCATAACTCGAGTTATGACTGGACACTCTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145438.1-914s1c1
Sequence:CCGGCTCTATACCTTACGGTCCCTTCTCGAGAAGGGACCGTAAGGTATAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087880    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145438.1-2827s1c1
Sequence:CCGGGCCAAGGTTTCTATCTGATATCTCGAGATATCAGATAGAAACCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145438
VALIDATED
LLGL2 MISSION shRNA shRNA Plasmid DNA
lethal giant larvae homolog 2 (Drosophila)
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000087878    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145438.1-3203s1c1
Sequence:CCGGCTGTGGGATGATCACACACTACTCGAGTAGTGTGTGATCATCCCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087882    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145438.1-2078s1c1
Sequence:CCGGCAGCAGAGTGTCCAGTCATAACTCGAGTTATGACTGGACACTCTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145438.1-914s1c1
Sequence:CCGGCTCTATACCTTACGGTCCCTTCTCGAGAAGGGACCGTAAGGTATAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087880    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145438.1-2827s1c1
Sequence:CCGGGCCAAGGTTTCTATCTGATATCTCGAGATATCAGATAGAAACCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145438
VALIDATED
LLGL2 MISSION shRNA Lentiviral Transduction Particles
lethal giant larvae homolog 2 (Drosophila)
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000087878    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145438.1-3203s1c1
Sequence:CCGGCTGTGGGATGATCACACACTACTCGAGTAGTGTGTGATCATCCCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087882    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145438.1-2078s1c1
Sequence:CCGGCAGCAGAGTGTCCAGTCATAACTCGAGTTATGACTGGACACTCTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145438.1-914s1c1
Sequence:CCGGCTCTATACCTTACGGTCCCTTCTCGAGAAGGGACCGTAAGGTATAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087880    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145438.1-2827s1c1
Sequence:CCGGGCCAAGGTTTCTATCTGATATCTCGAGATATCAGATAGAAACCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004524
LLGL2 MISSION shRNA Bacterial Glycerol Stock
lethal giant larvae homolog 2 (Drosophila)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000116432    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004524.2-3375s1c1
Sequence:CCGGCTGGGTCCTTTGGTCAATGTTCTCGAGAACATTGACCAAAGGACCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004524.2-2077s1c1
Sequence:CCGGCCGCGTCAAGTCCCTCAAGAACTCGAGTTCTTGAGGGACTTGACGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004524.2-217s1c1
Sequence:CCGGCCAGTTTAACAAGACGGTGGACTCGAGTCCACCGTCTTGTTAAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004524.2-2299s1c1
Sequence:CCGGCCTGTACTTTGCTGACACCTACTCGAGTAGGTGTCAGCAAAGTACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004524.2-983s1c1
Sequence:CCGGCCCTTTCCTTGCAAAGCGATTCTCGAGAATCGCTTTGCAAGGAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004524
LLGL2 MISSION shRNA shRNA Plasmid DNA
lethal giant larvae homolog 2 (Drosophila)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000116432    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004524.2-3375s1c1
Sequence:CCGGCTGGGTCCTTTGGTCAATGTTCTCGAGAACATTGACCAAAGGACCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004524.2-2077s1c1
Sequence:CCGGCCGCGTCAAGTCCCTCAAGAACTCGAGTTCTTGAGGGACTTGACGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004524.2-217s1c1
Sequence:CCGGCCAGTTTAACAAGACGGTGGACTCGAGTCCACCGTCTTGTTAAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004524.2-2299s1c1
Sequence:CCGGCCTGTACTTTGCTGACACCTACTCGAGTAGGTGTCAGCAAAGTACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004524.2-983s1c1
Sequence:CCGGCCCTTTCCTTGCAAAGCGATTCTCGAGAATCGCTTTGCAAGGAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004524
LLGL2 MISSION shRNA Lentiviral Transduction Particles
lethal giant larvae homolog 2 (Drosophila)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000116432    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004524.2-3375s1c1
Sequence:CCGGCTGGGTCCTTTGGTCAATGTTCTCGAGAACATTGACCAAAGGACCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004524.2-2077s1c1
Sequence:CCGGCCGCGTCAAGTCCCTCAAGAACTCGAGTTCTTGAGGGACTTGACGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004524.2-217s1c1
Sequence:CCGGCCAGTTTAACAAGACGGTGGACTCGAGTCCACCGTCTTGTTAAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004524.2-2299s1c1
Sequence:CCGGCCTGTACTTTGCTGACACCTACTCGAGTAGGTGTCAGCAAAGTACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004524.2-983s1c1
Sequence:CCGGCCCTTTCCTTGCAAAGCGATTCTCGAGAATCGCTTTGCAAGGAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks