EMAIL THIS PAGE TO A FRIEND

LMAN2

lectin, mannose-binding 2

Synonyms: C5orf8 GP36B VIP36
UniProtKB ID: Q12907, Q53HH1
Gene ID:
Human(10960) Summary: This gene encodes a type I transmembrane lectin that shuttles between the endoplasmic reticulum, the Golgi apparatus and the plasma membrane. The encoded protein binds high mannose type glycoproteins and may facilitate their sorting, trafficking and quality control. [provided by RefSeq, Oct 2008]
Mouse(66890) lectin, mannose-binding 2
Rat(290994) lectin, mannose-binding 2
Zebrafish(557960) lectin, mannose-binding 2
chicken(100859676) lectin, mannose-binding 2
cow(790870) lectin, mannose-binding 2
domestic cat(101099687) lectin, mannose-binding 2
dog(403938) lectin, mannose-binding 2
sheep(101122435) lectin, mannose-binding 2
domestic guinea pig(100735111) lectin, mannose-binding 2
naked mole-rat(101724120) lectin, mannose-binding 2
84 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV46788 Anti-LMAN2 (AB1) antibody produced in rabbit affinity isolated antibody zebrafish, bovine, human, rat, canine, rabbit, mouse, guinea pig, horse
immunohistochemistry, western blot pricing
AV46789 Anti-LMAN2 (AB2) antibody produced in rabbit affinity isolated antibody bovine, zebrafish, rat, guinea pig, rabbit, mouse, canine, human, pig, horse
western blot pricing
HPA003927 Anti-LMAN2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
SAB4200234 Anti-VIP36/ LMAN2 (C-terminal) antibody produced in rabbit ~1.0 mg/mL, affinity isolated antibody human
immunoprecipitation, western blot pricing
SAB4200233 Anti-VIP36/ LMAN2 antibody produced in rabbit ~1.0 mg/mL, affinity isolated antibody rat, human, mouse
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025828 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025828 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025828 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006816 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006816 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006816 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006816 Rosetta Predictions human pricing
NM_001115024 Rosetta Predictions rat pricing
XM_214428 Rosetta Predictions rat pricing
NM_025828 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006816 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00209153 predicted 467
2 SASI_Hs01_00209154 predicted 327
3 SASI_Hs01_00209155 predicted 658
4 SASI_Hs01_00209156 predicted 437
5 SASI_Hs01_00209157 predicted 237
6 SASI_Hs01_00209158 predicted 636
7 SASI_Hs01_00209160 predicted 327
8 SASI_Hs01_00209161 predicted 223
9 SASI_Hs02_00342359 predicted 217
10 SASI_Hs02_00342360 predicted 775
11 SASI_Hs01_00209159 predicted 529
12 SASI_Hs01_00209162 predicted 890
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001115024 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00252413 predicted 209
2 SASI_Rn02_00252414 predicted 251
3 SASI_Rn02_00252415 predicted 646
4 SASI_Rn02_00252416 predicted 833
5 SASI_Rn02_00252417 predicted 351
6 SASI_Rn02_00252418 predicted 751
7 SASI_Rn02_00252419 predicted 763
8 SASI_Rn02_00252420 predicted 298
9 SASI_Rn02_00252421 predicted 536
10 SASI_Rn02_00252422 predicted 822
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_214428 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00160911 predicted 285
2 SASI_Rn01_00160912 predicted 685
3 SASI_Rn01_00160913 predicted 871
4 SASI_Rn01_00160914 predicted 391
5 SASI_Rn01_00160915 predicted 791
6 SASI_Rn01_00160916 predicted 561
7 SASI_Rn01_00160917 predicted 796
8 SASI_Rn01_00160918 predicted 337
9 SASI_Rn01_00160919 predicted 570
10 SASI_Rn01_00160920 predicted 863
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025828 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00086501 predicted 527
2 SASI_Mm01_00086502 predicted 667
3 SASI_Mm01_00086503 predicted 323
4 SASI_Mm01_00086504 predicted 678
5 SASI_Mm01_00086505 predicted 829
6 SASI_Mm01_00086506 predicted 943
7 SASI_Mm01_00086507 predicted 722
8 SASI_Mm01_00086508 predicted 533
9 SASI_Mm01_00086509 predicted 983
10 SASI_Mm01_00086510 predicted 1000
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025828
VALIDATED
LMAN2 MISSION shRNA Bacterial Glycerol Stock
lectin, mannose-binding 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000348127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025828.3-940s21c1
Sequence:CCGGTGCCCACTGGCTACTACTTTGCTCGAGCAAAGTAGTAGCCAGTGGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025828.3-520s21c1
Sequence:CCGGGCTTCCTTAAGGACTGGGAAACTCGAGTTTCCCAGTCCTTAAGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025828.3-838s21c1
Sequence:CCGGCCTTCCTAGCTGTACGCTATTCTCGAGAATAGCGTACAGCTAGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025828.3-983s21c1
Sequence:CCGGCCTGTCTGACAACCACGACATCTCGAGATGTCGTGGTTGTCAGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025828.2-838s1c1
Sequence:CCGGCCTTCCTAGCTGTACGCTATTCTCGAGAATAGCGTACAGCTAGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025828.2-520s1c1
Sequence:CCGGGCTTCCTTAAGGACTGGGAAACTCGAGTTTCCCAGTCCTTAAGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025828.2-672s1c1
Sequence:CCGGGCCATCTTCCTGGACACGTATCTCGAGATACGTGTCCAGGAAGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025828.2-983s1c1
Sequence:CCGGCCTGTCTGACAACCACGACATCTCGAGATGTCGTGGTTGTCAGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111715    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025828.2-3135s1c1
Sequence:CCGGGCCTTCCTAATCAACACTGAACTCGAGTTCAGTGTTGATTAGGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025828
VALIDATED
LMAN2 MISSION shRNA shRNA Plasmid DNA
lectin, mannose-binding 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000348127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025828.3-940s21c1
Sequence:CCGGTGCCCACTGGCTACTACTTTGCTCGAGCAAAGTAGTAGCCAGTGGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025828.3-520s21c1
Sequence:CCGGGCTTCCTTAAGGACTGGGAAACTCGAGTTTCCCAGTCCTTAAGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025828.3-838s21c1
Sequence:CCGGCCTTCCTAGCTGTACGCTATTCTCGAGAATAGCGTACAGCTAGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025828.3-983s21c1
Sequence:CCGGCCTGTCTGACAACCACGACATCTCGAGATGTCGTGGTTGTCAGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025828.2-838s1c1
Sequence:CCGGCCTTCCTAGCTGTACGCTATTCTCGAGAATAGCGTACAGCTAGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025828.2-520s1c1
Sequence:CCGGGCTTCCTTAAGGACTGGGAAACTCGAGTTTCCCAGTCCTTAAGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025828.2-672s1c1
Sequence:CCGGGCCATCTTCCTGGACACGTATCTCGAGATACGTGTCCAGGAAGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025828.2-983s1c1
Sequence:CCGGCCTGTCTGACAACCACGACATCTCGAGATGTCGTGGTTGTCAGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111715    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025828.2-3135s1c1
Sequence:CCGGGCCTTCCTAATCAACACTGAACTCGAGTTCAGTGTTGATTAGGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025828
VALIDATED
LMAN2 MISSION shRNA Lentiviral Transduction Particles
lectin, mannose-binding 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000348127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025828.3-940s21c1
Sequence:CCGGTGCCCACTGGCTACTACTTTGCTCGAGCAAAGTAGTAGCCAGTGGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025828.3-520s21c1
Sequence:CCGGGCTTCCTTAAGGACTGGGAAACTCGAGTTTCCCAGTCCTTAAGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025828.3-838s21c1
Sequence:CCGGCCTTCCTAGCTGTACGCTATTCTCGAGAATAGCGTACAGCTAGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025828.3-983s21c1
Sequence:CCGGCCTGTCTGACAACCACGACATCTCGAGATGTCGTGGTTGTCAGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025828.2-838s1c1
Sequence:CCGGCCTTCCTAGCTGTACGCTATTCTCGAGAATAGCGTACAGCTAGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025828.2-520s1c1
Sequence:CCGGGCTTCCTTAAGGACTGGGAAACTCGAGTTTCCCAGTCCTTAAGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025828.2-672s1c1
Sequence:CCGGGCCATCTTCCTGGACACGTATCTCGAGATACGTGTCCAGGAAGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025828.2-983s1c1
Sequence:CCGGCCTGTCTGACAACCACGACATCTCGAGATGTCGTGGTTGTCAGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111715    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025828.2-3135s1c1
Sequence:CCGGGCCTTCCTAATCAACACTGAACTCGAGTTCAGTGTTGATTAGGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006816
VALIDATED
LMAN2 MISSION shRNA Bacterial Glycerol Stock
lectin, mannose-binding 2
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000142670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_006816.1-450s1c1
Sequence:CCGGCAAAGATAACTTCCACGGCTTCTCGAGAAGCCGTGGAAGTTATCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_006816.1-171s1c1
Sequence:CCGGGCATTCGCTCATTAAGCCCTACTCGAGTAGGGCTTAATGAGCGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140074    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006816.1-372s1c1
Sequence:CCGGGAAGAAGAACCTCCATGGAGACTCGAGTCTCCATGGAGGTTCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139112    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006816.1-1103s1c1
Sequence:CCGGCCAGGAGCCAATGTGAACTTTCTCGAGAAAGTTCACATTGGCTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139447    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_006816.1-131s1c1
Sequence:CCGGCGGATATAACTGACGGCAACACTCGAGTGTTGCCGTCAGTTATATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139772    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006816.1-288s1c1
Sequence:CCGGCAAAGAGGGCTCTATCTGGAACTCGAGTTCCAGATAGAGCCCTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140160    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006816.1-320s1c1
Sequence:CCGGGCTTCCTCAAAGACTGGGAAACTCGAGTTTCCCAGTCTTTGAGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006816.1-699s1c1
Sequence:CCGGGAACGAGTGGAAGAACTGCATCTCGAGATGCAGTTCTTCCACTCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_006816.1-337s1c1
Sequence:CCGGGAAATGCACGTCCACTTCAAACTCGAGTTTGAAGTGGACGTGCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006816.1-321s1c1
Sequence:CCGGCTTCCTCAAAGACTGGGAAATCTCGAGATTTCCCAGTCTTTGAGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006816.1-528s1c1
Sequence:CCGGCATCTCGGTGATGGTGAACAACTCGAGTTGTTCACCATCACCGAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_006816.1-705s1c1
Sequence:CCGGGTGGAAGAACTGCATTGACATCTCGAGATGTCAATGCAGTTCTTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006816
VALIDATED
LMAN2 MISSION shRNA shRNA Plasmid DNA
lectin, mannose-binding 2
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000142670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_006816.1-450s1c1
Sequence:CCGGCAAAGATAACTTCCACGGCTTCTCGAGAAGCCGTGGAAGTTATCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_006816.1-171s1c1
Sequence:CCGGGCATTCGCTCATTAAGCCCTACTCGAGTAGGGCTTAATGAGCGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140074    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006816.1-372s1c1
Sequence:CCGGGAAGAAGAACCTCCATGGAGACTCGAGTCTCCATGGAGGTTCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139112    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006816.1-1103s1c1
Sequence:CCGGCCAGGAGCCAATGTGAACTTTCTCGAGAAAGTTCACATTGGCTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139447    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_006816.1-131s1c1
Sequence:CCGGCGGATATAACTGACGGCAACACTCGAGTGTTGCCGTCAGTTATATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139772    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006816.1-288s1c1
Sequence:CCGGCAAAGAGGGCTCTATCTGGAACTCGAGTTCCAGATAGAGCCCTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140160    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006816.1-320s1c1
Sequence:CCGGGCTTCCTCAAAGACTGGGAAACTCGAGTTTCCCAGTCTTTGAGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006816.1-699s1c1
Sequence:CCGGGAACGAGTGGAAGAACTGCATCTCGAGATGCAGTTCTTCCACTCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_006816.1-337s1c1
Sequence:CCGGGAAATGCACGTCCACTTCAAACTCGAGTTTGAAGTGGACGTGCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006816.1-321s1c1
Sequence:CCGGCTTCCTCAAAGACTGGGAAATCTCGAGATTTCCCAGTCTTTGAGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006816.1-528s1c1
Sequence:CCGGCATCTCGGTGATGGTGAACAACTCGAGTTGTTCACCATCACCGAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_006816.1-705s1c1
Sequence:CCGGGTGGAAGAACTGCATTGACATCTCGAGATGTCAATGCAGTTCTTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006816
VALIDATED
LMAN2 MISSION shRNA Lentiviral Transduction Particles
lectin, mannose-binding 2
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000142670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_006816.1-450s1c1
Sequence:CCGGCAAAGATAACTTCCACGGCTTCTCGAGAAGCCGTGGAAGTTATCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_006816.1-171s1c1
Sequence:CCGGGCATTCGCTCATTAAGCCCTACTCGAGTAGGGCTTAATGAGCGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140074    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006816.1-372s1c1
Sequence:CCGGGAAGAAGAACCTCCATGGAGACTCGAGTCTCCATGGAGGTTCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139112    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006816.1-1103s1c1
Sequence:CCGGCCAGGAGCCAATGTGAACTTTCTCGAGAAAGTTCACATTGGCTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139447    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_006816.1-131s1c1
Sequence:CCGGCGGATATAACTGACGGCAACACTCGAGTGTTGCCGTCAGTTATATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139772    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006816.1-288s1c1
Sequence:CCGGCAAAGAGGGCTCTATCTGGAACTCGAGTTCCAGATAGAGCCCTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140160    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006816.1-320s1c1
Sequence:CCGGGCTTCCTCAAAGACTGGGAAACTCGAGTTTCCCAGTCTTTGAGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006816.1-699s1c1
Sequence:CCGGGAACGAGTGGAAGAACTGCATCTCGAGATGCAGTTCTTCCACTCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_006816.1-337s1c1
Sequence:CCGGGAAATGCACGTCCACTTCAAACTCGAGTTTGAAGTGGACGTGCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006816.1-321s1c1
Sequence:CCGGCTTCCTCAAAGACTGGGAAATCTCGAGATTTCCCAGTCTTTGAGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006816.1-528s1c1
Sequence:CCGGCATCTCGGTGATGGTGAACAACTCGAGTTGTTCACCATCACCGAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_006816.1-705s1c1
Sequence:CCGGGTGGAAGAACTGCATTGACATCTCGAGATGTCAATGCAGTTCTTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks