EMAIL THIS PAGE TO A FRIEND

LMCD1

LIM and cysteine-rich domains 1

UniProtKB ID: Q9NZU5
Gene ID:
Human(29995) Summary: This gene encodes a member of the LIM-domain family of zinc finger proteins. The encoded protein contains an N-terminal cysteine-rich domain and two C-terminal LIM domains. The presence of LIM domains suggests involvement in protein-protein interactions. The protein may act as a co-regulator of transcription along with other transcription factors. Alternate splicing results in multiple transcript variants of this gene. [provided by RefSeq, May 2013]
Mouse(30937) LIM and cysteine-rich domains 1
Rat(494021) LIM and cysteine-rich domains 1
chicken(416113) LIM and cysteine-rich domains 1
cow(540474) LIM and cysteine-rich domains 1
domestic cat(101081203) LIM and cysteine-rich domains 1
dog(476545) LIM and cysteine-rich domains 1
sheep(101107740) LIM and cysteine-rich domains 1
Domestic Rabbit(100345793) LIM and cysteine-rich domains 1
domestic guinea pig(100721965) LIM and cysteine-rich domains 1
naked mole-rat(101715617) LIM and cysteine-rich domains 1
137 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014583 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014583 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014583 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_144799 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144799 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144799 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU155951 MISSION® esiRNA esiRNA human LMCD1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014583 Rosetta Predictions human pricing
NM_001008562 Rosetta Predictions rat pricing
XM_001076072 Rosetta Predictions rat pricing
NM_144799 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014583 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00056170 predicted 1064
2 SASI_Hs01_00056172 predicted 272
3 SASI_Hs01_00056173 predicted 284
4 SASI_Hs01_00056174 predicted 806
5 SASI_Hs01_00056175 predicted 659
6 SASI_Hs01_00056176 predicted 814
7 SASI_Hs01_00056177 predicted 1080
8 SASI_Hs01_00056178 predicted 212
9 SASI_Hs01_00056179 predicted 1002
10 SASI_Hs02_00345857 predicted 876
11 SASI_Hs01_00056171 predicted 328
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008562 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00100712 predicted 346
2 SASI_Rn01_00100714 predicted 608
3 SASI_Rn01_00100715 predicted 1232
4 SASI_Rn02_00199242 predicted 279
5 SASI_Rn01_00100716 predicted 373
6 SASI_Rn01_00100717 predicted 801
7 SASI_Rn01_00100718 predicted 366
8 SASI_Rn02_00199243 predicted 851
9 SASI_Rn01_00100719 predicted 819
10 SASI_Rn01_00100720 predicted 995
11 SASI_Rn01_00100713 predicted 1036
12 SASI_Rn01_00100721 predicted 1132
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001076072 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00351977 predicted 983
2 SASI_Rn02_00351978 predicted 453
3 SASI_Rn02_00351979 predicted 1088
4 SASI_Rn02_00351980 predicted 221
5 SASI_Rn02_00351981 predicted 651
6 SASI_Rn02_00351982 predicted 212
7 SASI_Rn02_00351983 predicted 703
8 SASI_Rn02_00351984 predicted 668
9 SASI_Rn02_00351985 predicted 841
10 SASI_Rn02_00351986 predicted 975
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144799 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00133831 predicted 592
2 SASI_Mm01_00133832 predicted 1153
3 SASI_Mm01_00133833 predicted 926
4 SASI_Mm02_00340144 predicted 866
5 SASI_Mm02_00340145 predicted 454
6 SASI_Mm01_00133835 predicted 671
7 SASI_Mm01_00133837 predicted 884
8 SASI_Mm01_00133838 predicted 1263
9 SASI_Mm01_00133839 predicted 1250
10 SASI_Mm01_00133840 predicted 662
11 SASI_Mm01_00133834 predicted 298
12 SASI_Mm01_00133836 predicted 652
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014583
LMCD1 MISSION shRNA Bacterial Glycerol Stock
LIM and cysteine-rich domains 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000137306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014583.2-402s1c1
Sequence:CCGGGAACCGGATGATCATGACCAACTCGAGTTGGTCATGATCATCCGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014583.2-642s1c1
Sequence:CCGGGAATGAGTTGAAACTGATGGACTCGAGTCCATCAGTTTCAACTCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014583.2-1053s1c1
Sequence:CCGGGATAATATTCGCTGAGGACTACTCGAGTAGTCCTCAGCGAATATTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134099    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014583.2-1561s1c1
Sequence:CCGGCAAATCGCATAGCTGTAGAATCTCGAGATTCTACAGCTATGCGATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135991    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014583.2-1560s1c1
Sequence:CCGGGCAAATCGCATAGCTGTAGAACTCGAGTTCTACAGCTATGCGATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000439026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014583.2-277s21c1
Sequence:CCGGGAGGACCACTGCCTAACATCTCTCGAGAGATGTTAGGCAGTGGTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014583.2-1184s21c1
Sequence:CCGGCAACTTGCAGCAAGTCCAAACCTCGAGGTTTGGACTTGCTGCAAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014583.2-378s21c1
Sequence:CCGGGGACGGCATCCGGATTTACAACTCGAGTTGTAAATCCGGATGCCGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426911    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014583.2-1396s21c1
Sequence:CCGGTCCTTGAGGGTCAGTAGTTTCCTCGAGGAAACTACTGACCCTCAAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014583
LMCD1 MISSION shRNA shRNA Plasmid DNA
LIM and cysteine-rich domains 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000137306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014583.2-402s1c1
Sequence:CCGGGAACCGGATGATCATGACCAACTCGAGTTGGTCATGATCATCCGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014583.2-642s1c1
Sequence:CCGGGAATGAGTTGAAACTGATGGACTCGAGTCCATCAGTTTCAACTCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014583.2-1053s1c1
Sequence:CCGGGATAATATTCGCTGAGGACTACTCGAGTAGTCCTCAGCGAATATTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134099    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014583.2-1561s1c1
Sequence:CCGGCAAATCGCATAGCTGTAGAATCTCGAGATTCTACAGCTATGCGATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135991    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014583.2-1560s1c1
Sequence:CCGGGCAAATCGCATAGCTGTAGAACTCGAGTTCTACAGCTATGCGATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000439026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014583.2-277s21c1
Sequence:CCGGGAGGACCACTGCCTAACATCTCTCGAGAGATGTTAGGCAGTGGTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014583.2-1184s21c1
Sequence:CCGGCAACTTGCAGCAAGTCCAAACCTCGAGGTTTGGACTTGCTGCAAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014583.2-378s21c1
Sequence:CCGGGGACGGCATCCGGATTTACAACTCGAGTTGTAAATCCGGATGCCGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426911    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014583.2-1396s21c1
Sequence:CCGGTCCTTGAGGGTCAGTAGTTTCCTCGAGGAAACTACTGACCCTCAAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014583
LMCD1 MISSION shRNA Lentiviral Transduction Particles
LIM and cysteine-rich domains 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000137306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014583.2-402s1c1
Sequence:CCGGGAACCGGATGATCATGACCAACTCGAGTTGGTCATGATCATCCGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014583.2-642s1c1
Sequence:CCGGGAATGAGTTGAAACTGATGGACTCGAGTCCATCAGTTTCAACTCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014583.2-1053s1c1
Sequence:CCGGGATAATATTCGCTGAGGACTACTCGAGTAGTCCTCAGCGAATATTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134099    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014583.2-1561s1c1
Sequence:CCGGCAAATCGCATAGCTGTAGAATCTCGAGATTCTACAGCTATGCGATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135991    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014583.2-1560s1c1
Sequence:CCGGGCAAATCGCATAGCTGTAGAACTCGAGTTCTACAGCTATGCGATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000439026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014583.2-277s21c1
Sequence:CCGGGAGGACCACTGCCTAACATCTCTCGAGAGATGTTAGGCAGTGGTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014583.2-1184s21c1
Sequence:CCGGCAACTTGCAGCAAGTCCAAACCTCGAGGTTTGGACTTGCTGCAAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014583.2-378s21c1
Sequence:CCGGGGACGGCATCCGGATTTACAACTCGAGTTGTAAATCCGGATGCCGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426911    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014583.2-1396s21c1
Sequence:CCGGTCCTTGAGGGTCAGTAGTTTCCTCGAGGAAACTACTGACCCTCAAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144799
VALIDATED
LMCD1 MISSION shRNA Bacterial Glycerol Stock
LIM and cysteine-rich domains 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000098788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144799.1-400s1c1
Sequence:CCGGCATCTATAAGAGGAACCGCATCTCGAGATGCGGTTCCTCTTATAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144799.1-514s1c1
Sequence:CCGGCCTGCAGTACATGGAACTCATCTCGAGATGAGTTCCATGTACTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144799.1-1063s1c1
Sequence:CCGGGATCATCTTCTCAGAAGACTACTCGAGTAGTCTTCTGAGAAGATGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098785    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144799.1-1419s1c1
Sequence:CCGGCCAACTAAAGACACACTGGTACTCGAGTACCAGTGTGTCTTTAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144799.1-1156s1c1
Sequence:CCGGCCGTGCGTACATCGTCACCAACTCGAGTTGGTGACGATGTACGCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144799.1-1063s21c1
Sequence:CCGGGATCATCTTCTCAGAAGACTACTCGAGTAGTCTTCTGAGAAGATGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144799.1-400s21c1
Sequence:CCGGCATCTATAAGAGGAACCGCATCTCGAGATGCGGTTCCTCTTATAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144799.1-1156s21c1
Sequence:CCGGCCGTGCGTACATCGTCACCAACTCGAGTTGGTGACGATGTACGCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316334    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144799.1-1419s21c1
Sequence:CCGGCCAACTAAAGACACACTGGTACTCGAGTACCAGTGTGTCTTTAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144799.1-514s21c1
Sequence:CCGGCCTGCAGTACATGGAACTCATCTCGAGATGAGTTCCATGTACTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144799
VALIDATED
LMCD1 MISSION shRNA shRNA Plasmid DNA
LIM and cysteine-rich domains 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000098788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144799.1-400s1c1
Sequence:CCGGCATCTATAAGAGGAACCGCATCTCGAGATGCGGTTCCTCTTATAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144799.1-514s1c1
Sequence:CCGGCCTGCAGTACATGGAACTCATCTCGAGATGAGTTCCATGTACTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144799.1-1063s1c1
Sequence:CCGGGATCATCTTCTCAGAAGACTACTCGAGTAGTCTTCTGAGAAGATGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098785    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144799.1-1419s1c1
Sequence:CCGGCCAACTAAAGACACACTGGTACTCGAGTACCAGTGTGTCTTTAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144799.1-1156s1c1
Sequence:CCGGCCGTGCGTACATCGTCACCAACTCGAGTTGGTGACGATGTACGCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144799.1-1063s21c1
Sequence:CCGGGATCATCTTCTCAGAAGACTACTCGAGTAGTCTTCTGAGAAGATGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144799.1-400s21c1
Sequence:CCGGCATCTATAAGAGGAACCGCATCTCGAGATGCGGTTCCTCTTATAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144799.1-1156s21c1
Sequence:CCGGCCGTGCGTACATCGTCACCAACTCGAGTTGGTGACGATGTACGCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316334    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144799.1-1419s21c1
Sequence:CCGGCCAACTAAAGACACACTGGTACTCGAGTACCAGTGTGTCTTTAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144799.1-514s21c1
Sequence:CCGGCCTGCAGTACATGGAACTCATCTCGAGATGAGTTCCATGTACTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144799
VALIDATED
LMCD1 MISSION shRNA Lentiviral Transduction Particles
LIM and cysteine-rich domains 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000098788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144799.1-400s1c1
Sequence:CCGGCATCTATAAGAGGAACCGCATCTCGAGATGCGGTTCCTCTTATAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144799.1-514s1c1
Sequence:CCGGCCTGCAGTACATGGAACTCATCTCGAGATGAGTTCCATGTACTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144799.1-1063s1c1
Sequence:CCGGGATCATCTTCTCAGAAGACTACTCGAGTAGTCTTCTGAGAAGATGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098785    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144799.1-1419s1c1
Sequence:CCGGCCAACTAAAGACACACTGGTACTCGAGTACCAGTGTGTCTTTAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144799.1-1156s1c1
Sequence:CCGGCCGTGCGTACATCGTCACCAACTCGAGTTGGTGACGATGTACGCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144799.1-1063s21c1
Sequence:CCGGGATCATCTTCTCAGAAGACTACTCGAGTAGTCTTCTGAGAAGATGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144799.1-400s21c1
Sequence:CCGGCATCTATAAGAGGAACCGCATCTCGAGATGCGGTTCCTCTTATAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144799.1-1156s21c1
Sequence:CCGGCCGTGCGTACATCGTCACCAACTCGAGTTGGTGACGATGTACGCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316334    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144799.1-1419s21c1
Sequence:CCGGCCAACTAAAGACACACTGGTACTCGAGTACCAGTGTGTCTTTAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144799.1-514s21c1
Sequence:CCGGCCTGCAGTACATGGAACTCATCTCGAGATGAGTTCCATGTACTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks