EMAIL THIS PAGE TO A FRIEND

LMTK3

lemur tyrosine kinase 3

Synonyms: LMR3 TYKLM3
UniProtKB ID: Q96Q04, Q4G0U1
Gene ID:
Mouse(381983) lemur tyrosine kinase 3
domestic guinea pig(100731173) lemur tyrosine kinase 3
naked mole-rat(101724530) lemur tyrosine kinase 3
sheep(101106456) lemur tyrosine kinase 3
dog(100683761) lemur tyrosine kinase 3
cow(100140306) lemur tyrosine kinase 3
domestic cat(101087117) lemur tyrosine kinase 3
80 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_055866 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_055866 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_055866 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_356032 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_356032 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_356032 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001080434 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001080434 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001080434 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001005511 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001005511 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001005511 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080434 Rosetta Predictions human pricing
XM_055866 Rosetta Predictions human pricing
NM_001005511 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080434 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00314806 predicted 1223
2 SASI_Hs02_00314807 predicted 1044
3 SASI_Hs02_00314808 predicted 2776
4 SASI_Hs02_00314809 predicted 522
5 SASI_Hs02_00314810 predicted 364
6 SASI_Hs02_00314811 predicted 362
7 SASI_Hs02_00314812 predicted 520
8 SASI_Hs02_00314813 predicted 2629
9 SASI_Hs02_00314814 predicted 635
10 SASI_Hs02_00314815 predicted 2770
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_055866 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00297491 predicted 1226
2 SASI_Hs01_00297492 predicted 502
3 SASI_Hs01_00297493 predicted 1044
4 SASI_Hs01_00297494 predicted 2780
5 SASI_Hs01_00297495 predicted 528
6 SASI_Hs01_00297496 predicted 368
7 SASI_Hs01_00297497 predicted 369
8 SASI_Hs01_00297498 predicted 521
9 SASI_Hs01_00297499 predicted 2634
10 SASI_Hs01_00297500 predicted 1043
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005511 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00189464 predicted 931
2 SASI_Mm01_00189465 predicted 1021
3 SASI_Mm01_00189467 predicted 829
4 SASI_Mm01_00189468 predicted 794
5 SASI_Mm01_00189469 predicted 233
6 SASI_Mm01_00189470 predicted 1590
7 SASI_Mm01_00189471 predicted 3381
8 SASI_Mm02_00286622 predicted 1919
9 SASI_Mm01_00189472 predicted 1084
10 SASI_Mm01_00189473 predicted 349
11 SASI_Mm01_00189466 predicted 843
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_055866
LMTK3 MISSION shRNA Bacterial Glycerol Stock
lemur tyrosine kinase 3
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000199930    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_055866.8-4371s1c1
Sequence:CCGGGCTGTGCTTCTCCCGCTTCTCCTCGAGGAGAAGCGGGAGAAGCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_055866.8-1288s1c1
Sequence:CCGGGCCTCTGATCTCCAATTGCAGCTCGAGCTGCAATTGGAGATCAGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_055866.8-2686s1c1
Sequence:CCGGCGGGAGGATGTGACAAGGAACCTCGAGGTTCCTTGTCACATCCTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_055866.8-374s1c1
Sequence:CCGGCGCTGCCTGATGTCTACATTCCTCGAGGAATGTAGACATCAGGCAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_055866.8-435s1c1
Sequence:CCGGGCCTTCACACTCAGACATGACCTCGAGGTCATGTCTGAGTGTGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199869    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_055866.8-4732s1c1
Sequence:CCGGGAGCCGCCTTTCTCGGAACTGCTCGAGCAGTTCCGAGAAAGGCGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_055866.5-3708s1c1
Sequence:CCGGGCCACGACTATTCTTGGACTTCTCGAGAAGTCCAAGAATAGTCGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_055866.5-1228s1c1
Sequence:CCGGGCGGACTACTGGTATGACATTCTCGAGAATGTCATACCAGTAGTCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_055866.5-696s1c1
Sequence:CCGGGCTGCCGTTTCTGCTGATTATCTCGAGATAATCAGCAGAAACGGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_055866.5-288s1c1
Sequence:CCGGCGGCTTCAAGGAATTTGAGAACTCGAGTTCTCAAATTCCTTGAAGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021484    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_055866.5-4745s1c1
Sequence:CCGGCGGAACTGAACTGAACTCTTTCTCGAGAAAGAGTTCAGTTCAGTTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_055866
LMTK3 MISSION shRNA shRNA Plasmid DNA
lemur tyrosine kinase 3
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000199930    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_055866.8-4371s1c1
Sequence:CCGGGCTGTGCTTCTCCCGCTTCTCCTCGAGGAGAAGCGGGAGAAGCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_055866.8-1288s1c1
Sequence:CCGGGCCTCTGATCTCCAATTGCAGCTCGAGCTGCAATTGGAGATCAGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_055866.8-2686s1c1
Sequence:CCGGCGGGAGGATGTGACAAGGAACCTCGAGGTTCCTTGTCACATCCTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_055866.8-374s1c1
Sequence:CCGGCGCTGCCTGATGTCTACATTCCTCGAGGAATGTAGACATCAGGCAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_055866.8-435s1c1
Sequence:CCGGGCCTTCACACTCAGACATGACCTCGAGGTCATGTCTGAGTGTGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199869    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_055866.8-4732s1c1
Sequence:CCGGGAGCCGCCTTTCTCGGAACTGCTCGAGCAGTTCCGAGAAAGGCGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_055866.5-3708s1c1
Sequence:CCGGGCCACGACTATTCTTGGACTTCTCGAGAAGTCCAAGAATAGTCGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_055866.5-1228s1c1
Sequence:CCGGGCGGACTACTGGTATGACATTCTCGAGAATGTCATACCAGTAGTCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_055866.5-696s1c1
Sequence:CCGGGCTGCCGTTTCTGCTGATTATCTCGAGATAATCAGCAGAAACGGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_055866.5-288s1c1
Sequence:CCGGCGGCTTCAAGGAATTTGAGAACTCGAGTTCTCAAATTCCTTGAAGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021484    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_055866.5-4745s1c1
Sequence:CCGGCGGAACTGAACTGAACTCTTTCTCGAGAAAGAGTTCAGTTCAGTTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_055866
LMTK3 MISSION shRNA Lentiviral Transduction Particles
lemur tyrosine kinase 3
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000199930    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_055866.8-4371s1c1
Sequence:CCGGGCTGTGCTTCTCCCGCTTCTCCTCGAGGAGAAGCGGGAGAAGCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_055866.8-1288s1c1
Sequence:CCGGGCCTCTGATCTCCAATTGCAGCTCGAGCTGCAATTGGAGATCAGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_055866.8-2686s1c1
Sequence:CCGGCGGGAGGATGTGACAAGGAACCTCGAGGTTCCTTGTCACATCCTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_055866.8-374s1c1
Sequence:CCGGCGCTGCCTGATGTCTACATTCCTCGAGGAATGTAGACATCAGGCAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_055866.8-435s1c1
Sequence:CCGGGCCTTCACACTCAGACATGACCTCGAGGTCATGTCTGAGTGTGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199869    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_055866.8-4732s1c1
Sequence:CCGGGAGCCGCCTTTCTCGGAACTGCTCGAGCAGTTCCGAGAAAGGCGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_055866.5-3708s1c1
Sequence:CCGGGCCACGACTATTCTTGGACTTCTCGAGAAGTCCAAGAATAGTCGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_055866.5-1228s1c1
Sequence:CCGGGCGGACTACTGGTATGACATTCTCGAGAATGTCATACCAGTAGTCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_055866.5-696s1c1
Sequence:CCGGGCTGCCGTTTCTGCTGATTATCTCGAGATAATCAGCAGAAACGGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_055866.5-288s1c1
Sequence:CCGGCGGCTTCAAGGAATTTGAGAACTCGAGTTCTCAAATTCCTTGAAGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021484    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_055866.5-4745s1c1
Sequence:CCGGCGGAACTGAACTGAACTCTTTCTCGAGAAAGAGTTCAGTTCAGTTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_356032
LMTK3 MISSION shRNA Bacterial Glycerol Stock
lemur tyrosine kinase 3
Mouse
2 Products Total
TRC Number Price Set Price (2)? Select
TRCN0000023374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_356032.1-549s1c1
Sequence:CCGGCTTCCTGTTGATCATGGAGTTCTCGAGAACTCCATGATCAACAGGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_356032.1-103s1c1
Sequence:CCGGCTTACCTGTCTGTGTTGCAAACTCGAGTTTGCAACACAGACAGGTAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_356032
LMTK3 MISSION shRNA shRNA Plasmid DNA
lemur tyrosine kinase 3
Mouse
2 Products Total
TRC Number Vector Price Set Price (2)? Select
TRCN0000023374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_356032.1-549s1c1
Sequence:CCGGCTTCCTGTTGATCATGGAGTTCTCGAGAACTCCATGATCAACAGGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_356032.1-103s1c1
Sequence:CCGGCTTACCTGTCTGTGTTGCAAACTCGAGTTTGCAACACAGACAGGTAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_356032
LMTK3 MISSION shRNA Lentiviral Transduction Particles
lemur tyrosine kinase 3
Mouse
2 Products Total
TRC Number Volume Titer Vector Price Set Price (2)? Select
TRCN0000023374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_356032.1-549s1c1
Sequence:CCGGCTTCCTGTTGATCATGGAGTTCTCGAGAACTCCATGATCAACAGGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_356032.1-103s1c1
Sequence:CCGGCTTACCTGTCTGTGTTGCAAACTCGAGTTTGCAACACAGACAGGTAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080434
LMTK3 MISSION shRNA Bacterial Glycerol Stock
lemur tyrosine kinase 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000368516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080434.1-1229s21c1
Sequence:CCGGCGGACTACTGGTATGACATTCCTCGAGGAATGTCATACCAGTAGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080434.1-697s21c1
Sequence:CCGGCTGCCGTTTCTGCTGATTATGCTCGAGCATAATCAGCAGAAACGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080434.1-1686s21c1
Sequence:CCGGCGTGAGCAGCGAGTACTACATCTCGAGATGTAGTACTCGCTGCTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080434.1-3743s21c1
Sequence:CCGGGGAACAGCGAGCAGATCAAAGCTCGAGCTTTGATCTGCTCGCTGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000282431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080434.1-485s21c1
Sequence:CCGGTGAGCTACCTGCAGGAGATTGCTCGAGCAATCTCCTGCAGGTAGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000282433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080434.1-4323s21c1
Sequence:CCGGTTTCGAGTGGGCGGAGGATTTCTCGAGAAATCCTCCGCCCACTCGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358261    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080434.1-4724s21c1
Sequence:CCGGTCCATAGAGAGCCGCCTTTCTCTCGAGAGAAAGGCGGCTCTCTATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080434.1-284s21c1
Sequence:CCGGATGTCGGCTTCAAGGAATTTGCTCGAGCAAATTCCTTGAAGCCGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080434
LMTK3 MISSION shRNA shRNA Plasmid DNA
lemur tyrosine kinase 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000368516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080434.1-1229s21c1
Sequence:CCGGCGGACTACTGGTATGACATTCCTCGAGGAATGTCATACCAGTAGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080434.1-697s21c1
Sequence:CCGGCTGCCGTTTCTGCTGATTATGCTCGAGCATAATCAGCAGAAACGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080434.1-1686s21c1
Sequence:CCGGCGTGAGCAGCGAGTACTACATCTCGAGATGTAGTACTCGCTGCTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080434.1-3743s21c1
Sequence:CCGGGGAACAGCGAGCAGATCAAAGCTCGAGCTTTGATCTGCTCGCTGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000282431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080434.1-485s21c1
Sequence:CCGGTGAGCTACCTGCAGGAGATTGCTCGAGCAATCTCCTGCAGGTAGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000282433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080434.1-4323s21c1
Sequence:CCGGTTTCGAGTGGGCGGAGGATTTCTCGAGAAATCCTCCGCCCACTCGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358261    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080434.1-4724s21c1
Sequence:CCGGTCCATAGAGAGCCGCCTTTCTCTCGAGAGAAAGGCGGCTCTCTATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080434.1-284s21c1
Sequence:CCGGATGTCGGCTTCAAGGAATTTGCTCGAGCAAATTCCTTGAAGCCGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080434
LMTK3 MISSION shRNA Lentiviral Transduction Particles
lemur tyrosine kinase 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000368516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080434.1-1229s21c1
Sequence:CCGGCGGACTACTGGTATGACATTCCTCGAGGAATGTCATACCAGTAGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080434.1-697s21c1
Sequence:CCGGCTGCCGTTTCTGCTGATTATGCTCGAGCATAATCAGCAGAAACGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080434.1-1686s21c1
Sequence:CCGGCGTGAGCAGCGAGTACTACATCTCGAGATGTAGTACTCGCTGCTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080434.1-3743s21c1
Sequence:CCGGGGAACAGCGAGCAGATCAAAGCTCGAGCTTTGATCTGCTCGCTGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000282431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080434.1-485s21c1
Sequence:CCGGTGAGCTACCTGCAGGAGATTGCTCGAGCAATCTCCTGCAGGTAGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000282433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080434.1-4323s21c1
Sequence:CCGGTTTCGAGTGGGCGGAGGATTTCTCGAGAAATCCTCCGCCCACTCGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358261    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080434.1-4724s21c1
Sequence:CCGGTCCATAGAGAGCCGCCTTTCTCTCGAGAGAAAGGCGGCTCTCTATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080434.1-284s21c1
Sequence:CCGGATGTCGGCTTCAAGGAATTTGCTCGAGCAAATTCCTTGAAGCCGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001005511
LMTK3 MISSION shRNA Bacterial Glycerol Stock
lemur tyrosine kinase 3
Mouse
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000361051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005511.2-1034s21c1
Sequence:CCGGCTTCGTGCTGGTAGATCAAAGCTCGAGCTTTGATCTACCAGCACGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005511.2-1213s21c1
Sequence:CCGGCTGACTATTGGTATGACATTTCTCGAGAAATGTCATACCAATAGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005511.2-1669s21c1
Sequence:CCGGCGGTGAGCAGCGAGTACTATACTCGAGTATAGTACTCGCTGCTCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001005511
LMTK3 MISSION shRNA shRNA Plasmid DNA
lemur tyrosine kinase 3
Mouse
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000361051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005511.2-1034s21c1
Sequence:CCGGCTTCGTGCTGGTAGATCAAAGCTCGAGCTTTGATCTACCAGCACGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005511.2-1213s21c1
Sequence:CCGGCTGACTATTGGTATGACATTTCTCGAGAAATGTCATACCAATAGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005511.2-1669s21c1
Sequence:CCGGCGGTGAGCAGCGAGTACTATACTCGAGTATAGTACTCGCTGCTCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001005511
LMTK3 MISSION shRNA Lentiviral Transduction Particles
lemur tyrosine kinase 3
Mouse
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000361051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005511.2-1034s21c1
Sequence:CCGGCTTCGTGCTGGTAGATCAAAGCTCGAGCTTTGATCTACCAGCACGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005511.2-1213s21c1
Sequence:CCGGCTGACTATTGGTATGACATTTCTCGAGAAATGTCATACCAATAGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005511.2-1669s21c1
Sequence:CCGGCGGTGAGCAGCGAGTACTATACTCGAGTATAGTACTCGCTGCTCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks