EMAIL THIS PAGE TO A FRIEND

LMX1A

LIM homeobox transcription factor 1, alpha

Synonyms: LMX1 LMX1.1
UniProtKB ID: Q8TE12, B3KXP6, Q0VDB5, Q5VWG4, Q8TE11
Gene ID:
Human(4009) Summary: This gene encodes a homeodomain and LIM-domain containing protein. The encoded protein is a transcription factor that acts as a positive regulator of insulin gene transcription. This gene also plays a role in the development of dopamine producing neurons during embryogenesis. Mutations in this gene are associated with an increased risk of developing Parkinson's disease. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Feb 2012]
Mouse(110648) LIM homeobox transcription factor 1 alpha
Rat(289201) LIM homeobox transcription factor 1 alpha
sheep(101111592) LIM homeobox transcription factor 1, alpha
domestic guinea pig(100726831) LIM homeobox transcription factor 1, alpha
naked mole-rat(101715780) LIM homeobox transcription factor 1, alpha
Zebrafish(558036) LIM homeobox transcription factor 1, alpha
cow(510296) LIM homeobox transcription factor 1, alpha
Horse(100058469) LIM homeobox transcription factor 1, alpha
domestic cat(101081519) LIM homeobox transcription factor 1, alpha
dog(609061) LIM homeobox transcription factor 1, alpha
chicken(777133) LIM homeobox transcription factor 1, alpha
152 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033652 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_033652 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_033652 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_177398 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_177398 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_177398 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001033507 Rosetta Predictions human pricing
NM_177398 Rosetta Predictions human pricing
NM_177399 Rosetta Predictions human pricing
NM_001105967 Rosetta Predictions rat pricing
NM_033652 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033507 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00162557 predicted 652
2 SASI_Hs01_00162558 predicted 918
3 SASI_Hs01_00162560 predicted 951
4 SASI_Hs01_00162561 predicted 804
5 SASI_Hs02_00308030 predicted 644
6 SASI_Hs01_00162562 predicted 984
7 SASI_Hs01_00162563 predicted 1007
8 SASI_Hs02_00308031 predicted 748
9 SASI_Hs01_00162564 predicted 1098
10 SASI_Hs01_00162565 predicted 1057
11 SASI_Hs01_00162559 predicted 790
12 SASI_Hs01_00162566 predicted 1131
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177398 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00041962 predicted 1246
2 SASI_Hs01_00041963 predicted 1508
3 SASI_Hs01_00041965 predicted 1543
4 SASI_Hs01_00041966 predicted 1397
5 SASI_Hs02_00369293 predicted 1238
6 SASI_Hs01_00041967 predicted 760
7 SASI_Hs01_00041968 predicted 609
8 SASI_Hs01_00041969 predicted 465
9 SASI_Hs01_00041970 predicted 808
10 SASI_Hs01_00041971 predicted 1342
11 SASI_Hs01_00041964 predicted 1385
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177399 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00163305 predicted 524
2 SASI_Hs01_00163306 predicted 788
3 SASI_Hs01_00163308 predicted 818
4 SASI_Hs01_00163309 predicted 674
5 SASI_Hs02_00369294 predicted 515
6 SASI_Hs01_00163310 predicted 854
7 SASI_Hs01_00163311 predicted 869
8 SASI_Hs01_00163312 predicted 967
9 SASI_Hs01_00163313 predicted 926
10 SASI_Hs02_00369295 predicted 774
11 SASI_Hs01_00163307 predicted 663
12 SASI_Hs01_00163314 predicted 999
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105967 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00214312 predicted 457
2 SASI_Rn02_00214313 predicted 1127
3 SASI_Rn02_00214314 predicted 466
4 SASI_Rn02_00214315 predicted 710
5 SASI_Rn02_00214316 predicted 1031
6 SASI_Rn02_00214317 predicted 1333
7 SASI_Rn02_00214318 predicted 447
8 SASI_Rn02_00214319 predicted 1333
9 SASI_Rn02_00214320 predicted 807
10 SASI_Rn02_00214321 predicted 1242
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033652 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00035298 predicted 1115
2 SASI_Mm01_00035299 predicted 460
3 SASI_Mm01_00035300 predicted 1195
4 SASI_Mm01_00035301 predicted 1128
5 SASI_Mm01_00035302 predicted 469
6 SASI_Mm01_00035303 predicted 1388
7 SASI_Mm01_00035304 predicted 1028
8 SASI_Mm02_00337487 predicted 1339
9 SASI_Mm01_00035305 predicted 806
10 SASI_Mm01_00035306 predicted 447
11 SASI_Mm01_00035307 predicted 847
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033652
LMX1A MISSION shRNA Bacterial Glycerol Stock
LIM homeobox transcription factor 1, alpha
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433282    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033652.5-1541s21c1
Sequence:CCGGCATTATGGATTGCATAGTTTACTCGAGTAAACTATGCAATCCATAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415771    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033652.5-1419s21c1
Sequence:CCGGTGTGAAGGGTTGCTGACTTTACTCGAGTAAAGTCAGCAACCCTTCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033652.5-478s21c1
Sequence:CCGGGAAACTGTTTGCTGTCAAATGCTCGAGCATTTGACAGCAAACAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033652.2-1134s1c1
Sequence:CCGGCGTCTACAACTCTGATCCCTTCTCGAGAAGGGATCAGAGTTGTAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033652.2-270s1c1
Sequence:CCGGCTCGGCATCTTTCTCCTCTTTCTCGAGAAAGAGGAGAAAGATGCCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033652.2-1239s1c1
Sequence:CCGGTGATGACACATCTCTCAGTAACTCGAGTTACTGAGAGATGTGTCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033652.2-1202s1c1
Sequence:CCGGCCTATGGTGCTGAACCTCTTTCTCGAGAAAGAGGTTCAGCACCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033652.2-456s1c1
Sequence:CCGGGCTCTACTGCAAGTACCACTACTCGAGTAGTGGTACTTGCAGTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033652
LMX1A MISSION shRNA shRNA Plasmid DNA
LIM homeobox transcription factor 1, alpha
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433282    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033652.5-1541s21c1
Sequence:CCGGCATTATGGATTGCATAGTTTACTCGAGTAAACTATGCAATCCATAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415771    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033652.5-1419s21c1
Sequence:CCGGTGTGAAGGGTTGCTGACTTTACTCGAGTAAAGTCAGCAACCCTTCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033652.5-478s21c1
Sequence:CCGGGAAACTGTTTGCTGTCAAATGCTCGAGCATTTGACAGCAAACAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033652.2-1134s1c1
Sequence:CCGGCGTCTACAACTCTGATCCCTTCTCGAGAAGGGATCAGAGTTGTAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033652.2-270s1c1
Sequence:CCGGCTCGGCATCTTTCTCCTCTTTCTCGAGAAAGAGGAGAAAGATGCCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033652.2-1239s1c1
Sequence:CCGGTGATGACACATCTCTCAGTAACTCGAGTTACTGAGAGATGTGTCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033652.2-1202s1c1
Sequence:CCGGCCTATGGTGCTGAACCTCTTTCTCGAGAAAGAGGTTCAGCACCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033652.2-456s1c1
Sequence:CCGGGCTCTACTGCAAGTACCACTACTCGAGTAGTGGTACTTGCAGTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033652
LMX1A MISSION shRNA Lentiviral Transduction Particles
LIM homeobox transcription factor 1, alpha
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433282    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033652.5-1541s21c1
Sequence:CCGGCATTATGGATTGCATAGTTTACTCGAGTAAACTATGCAATCCATAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415771    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033652.5-1419s21c1
Sequence:CCGGTGTGAAGGGTTGCTGACTTTACTCGAGTAAAGTCAGCAACCCTTCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033652.5-478s21c1
Sequence:CCGGGAAACTGTTTGCTGTCAAATGCTCGAGCATTTGACAGCAAACAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033652.2-1134s1c1
Sequence:CCGGCGTCTACAACTCTGATCCCTTCTCGAGAAGGGATCAGAGTTGTAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033652.2-270s1c1
Sequence:CCGGCTCGGCATCTTTCTCCTCTTTCTCGAGAAAGAGGAGAAAGATGCCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033652.2-1239s1c1
Sequence:CCGGTGATGACACATCTCTCAGTAACTCGAGTTACTGAGAGATGTGTCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033652.2-1202s1c1
Sequence:CCGGCCTATGGTGCTGAACCTCTTTCTCGAGAAAGAGGTTCAGCACCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033652.2-456s1c1
Sequence:CCGGGCTCTACTGCAAGTACCACTACTCGAGTAGTGGTACTTGCAGTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177398
LMX1A MISSION shRNA Bacterial Glycerol Stock
LIM homeobox transcription factor 1, alpha
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000427670    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177398.2-1777s21c1
Sequence:CCGGAGTGTGTAACCTTTCGTATTTCTCGAGAAATACGAAAGGTTACACACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017213    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177398.1-1400s1c1
Sequence:CCGGCCCATATGGAACAACCATATTCTCGAGAATATGGTTGTTCCATATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177398.1-702s1c1
Sequence:CCGGGCAGCCTCAGACTCAGGTAAACTCGAGTTTACCTGAGTCTGAGGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177398.1-1131s1c1
Sequence:CCGGCAGAGTGTCTACAGCTCAGATCTCGAGATCTGAGCTGTAGACACTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177398.1-1252s1c1
Sequence:CCGGCCCTCAGTAACCTGGGTGATTCTCGAGAATCACCCAGGTTACTGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177398.1-458s1c1
Sequence:CCGGGCTGTACTGCAAGTATGACTACTCGAGTAGTCATACTTGCAGTACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177398
LMX1A MISSION shRNA shRNA Plasmid DNA
LIM homeobox transcription factor 1, alpha
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000427670    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177398.2-1777s21c1
Sequence:CCGGAGTGTGTAACCTTTCGTATTTCTCGAGAAATACGAAAGGTTACACACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017213    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177398.1-1400s1c1
Sequence:CCGGCCCATATGGAACAACCATATTCTCGAGAATATGGTTGTTCCATATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177398.1-702s1c1
Sequence:CCGGGCAGCCTCAGACTCAGGTAAACTCGAGTTTACCTGAGTCTGAGGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177398.1-1131s1c1
Sequence:CCGGCAGAGTGTCTACAGCTCAGATCTCGAGATCTGAGCTGTAGACACTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177398.1-1252s1c1
Sequence:CCGGCCCTCAGTAACCTGGGTGATTCTCGAGAATCACCCAGGTTACTGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177398.1-458s1c1
Sequence:CCGGGCTGTACTGCAAGTATGACTACTCGAGTAGTCATACTTGCAGTACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177398
LMX1A MISSION shRNA Lentiviral Transduction Particles
LIM homeobox transcription factor 1, alpha
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000427670    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177398.2-1777s21c1
Sequence:CCGGAGTGTGTAACCTTTCGTATTTCTCGAGAAATACGAAAGGTTACACACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017213    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177398.1-1400s1c1
Sequence:CCGGCCCATATGGAACAACCATATTCTCGAGAATATGGTTGTTCCATATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177398.1-702s1c1
Sequence:CCGGGCAGCCTCAGACTCAGGTAAACTCGAGTTTACCTGAGTCTGAGGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177398.1-1131s1c1
Sequence:CCGGCAGAGTGTCTACAGCTCAGATCTCGAGATCTGAGCTGTAGACACTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177398.1-1252s1c1
Sequence:CCGGCCCTCAGTAACCTGGGTGATTCTCGAGAATCACCCAGGTTACTGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177398.1-458s1c1
Sequence:CCGGGCTGTACTGCAAGTATGACTACTCGAGTAGTCATACTTGCAGTACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks