EMAIL THIS PAGE TO A FRIEND

LMX1B

LIM homeobox transcription factor 1, beta

Synonyms: LMX1.2 NPS1
UniProtKB ID: O60663, F8W7W6, O75463, Q5JU95, Q6ISC9
Gene ID:
Human(4010) Summary: This gene encodes a member of LIM-homeodomain family of proteins containing two N-terminal zinc-binding LIM domains, 1 homeodomain, and a C-terminal glutamine-rich domain. It functions as a transcription factor, and is essential for the normal development of dorsal limb structures, the glomerular basement membrane, the anterior segment of the eye, and dopaminergic and serotonergic neurons. Mutations in this gene are associated with nail-patella syndrome. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2010]
Mouse(16917) LIM homeobox transcription factor 1 beta
Rat(114501) LIM homeobox transcription factor 1 beta
chicken(396312) LIM homeobox transcription factor 1, beta
cow(100337389) LIM homeobox transcription factor 1, beta-like
domestic cat(101086098) LIM homeobox transcription factor 1, beta
dog(403499) LIM homeobox transcription factor 1, beta
domestic guinea pig(100728241) LIM homeobox transcription factor 1, beta
naked mole-rat(101708650) LIM homeobox transcription factor 1, beta
sheep(101105482) LIM homeobox transcription factor 1, beta
84 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010725 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010725 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010725 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002316 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002316 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002316 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002316 Rosetta Predictions human pricing
XM_001069713 Rosetta Predictions rat pricing
XM_001078691 Rosetta Predictions rat pricing
XM_001078699 Rosetta Predictions rat pricing
XM_342419 Rosetta Predictions rat pricing
NM_010725 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002316 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00333633 predicted 1305
2 SASI_Hs02_00333634 predicted 1008
3 SASI_Hs02_00333635 predicted 1569
4 SASI_Hs02_00333636 predicted 1008
5 SASI_Hs02_00333637 predicted 1247
6 SASI_Hs02_00333638 predicted 686
7 SASI_Hs01_00029050 predicted 533
8 SASI_Hs01_00029051 predicted 278
9 SASI_Hs02_00333639 predicted 479
10 SASI_Hs01_00029052 predicted 264
11 SASI_Hs01_00029048 predicted 837
12 SASI_Hs01_00029049 predicted 212
13 SASI_Hs01_00029053 predicted 668
14 SASI_Hs01_00029054 predicted 215
15 SASI_Hs01_00029055 predicted 601
16 SASI_Hs01_00029056 predicted 649
17 SASI_Hs01_00029057 predicted 639
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001069713 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00329011 predicted 618
2 SASI_Rn02_00329012 predicted 591
3 SASI_Rn02_00329013 predicted 208
4 SASI_Rn02_00329014 predicted 473
5 SASI_Rn02_00329015 predicted 257
6 SASI_Rn02_00329016 predicted 243
7 SASI_Rn02_00329017 predicted 613
8 SASI_Rn02_00329018 predicted 214
9 SASI_Rn02_00329019 predicted 211
10 SASI_Rn02_00329020 predicted 634
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001078691 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00361728 predicted 540
2 SASI_Rn02_00361729 predicted 659
3 SASI_Rn02_00361730 predicted 745
4 SASI_Rn02_00361731 predicted 321
5 SASI_Rn02_00361732 predicted 674
6 SASI_Rn02_00361733 predicted 876
7 SASI_Rn02_00361734 predicted 313
8 SASI_Rn02_00361735 predicted 688
9 SASI_Rn02_00361736 predicted 282
10 SASI_Rn02_00361737 predicted 743
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001078699 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00361758 predicted 476
2 SASI_Rn02_00361759 predicted 593
3 SASI_Rn02_00361760 predicted 672
4 SASI_Rn02_00361761 predicted 255
5 SASI_Rn02_00361762 predicted 609
6 SASI_Rn02_00361763 predicted 813
7 SASI_Rn02_00361764 predicted 244
8 SASI_Rn02_00361765 predicted 614
9 SASI_Rn02_00361766 predicted 214
10 SASI_Rn02_00361767 predicted 678
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_342419 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00394237 predicted 684
2 SASI_Rn01_00135096 predicted 665
3 SASI_Rn01_00135097 predicted 278
4 SASI_Rn01_00135098 predicted 548
5 SASI_Rn01_00135099 predicted 320
6 SASI_Rn01_00135101 predicted 321
7 SASI_Rn01_00135102 predicted 688
8 SASI_Rn01_00135103 predicted 289
9 SASI_Rn01_00135105 predicted 279
10 SASI_Rn02_00394238 predicted 709
11 SASI_Rn01_00135100 predicted 307
12 SASI_Rn01_00135104 predicted 292
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010725 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00111954 predicted 422
2 SASI_Mm01_00111955 predicted 619
3 SASI_Mm01_00111957 predicted 256
4 SASI_Mm01_00111958 predicted 602
5 SASI_Mm01_00111959 predicted 611
6 SASI_Mm01_00111960 predicted 674
7 SASI_Mm01_00111961 predicted 634
8 SASI_Mm01_00111962 predicted 814
9 SASI_Mm01_00111963 predicted 612
10 SASI_Mm02_00319212 predicted 228
11 SASI_Mm01_00111956 predicted 720
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010725
LMX1B MISSION shRNA Bacterial Glycerol Stock
LIM homeobox transcription factor 1, beta
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000070593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010725.1-333s1c1
Sequence:CCGGTGTGTACCACTTGGGCTGTTTCTCGAGAAACAGCCCAAGTGGTACACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010725.1-252s1c1
Sequence:CCGGCCAACAGCTCTTCGCGGCAAACTCGAGTTTGCCGCGAAGAGCTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010725.1-417s1c1
Sequence:CCGGGCTGCTGTGCAAGGGTGACTACTCGAGTAGTCACCCTTGCACAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010725.1-544s1c1
Sequence:CCGGCAGAGTAAAGGCAGTGGAGATCTCGAGATCTCCACTGCCTTTACTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010725.2-134s21c1
Sequence:CCGGTGATGCGAGTCAACGAGTCGTCTCGAGACGACTCGTTGACTCGCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010725.2-625s21c1
Sequence:CCGGAGAGCTTTCAAGGCATCCTTTCTCGAGAAAGGATGCCTTGAAAGCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010725.2-666s21c1
Sequence:CCGGTCGGAAGGTCCGAGAGACATTCTCGAGAATGTCTCTCGGACCTTCCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010725
LMX1B MISSION shRNA shRNA Plasmid DNA
LIM homeobox transcription factor 1, beta
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000070593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010725.1-333s1c1
Sequence:CCGGTGTGTACCACTTGGGCTGTTTCTCGAGAAACAGCCCAAGTGGTACACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010725.1-252s1c1
Sequence:CCGGCCAACAGCTCTTCGCGGCAAACTCGAGTTTGCCGCGAAGAGCTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010725.1-417s1c1
Sequence:CCGGGCTGCTGTGCAAGGGTGACTACTCGAGTAGTCACCCTTGCACAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010725.1-544s1c1
Sequence:CCGGCAGAGTAAAGGCAGTGGAGATCTCGAGATCTCCACTGCCTTTACTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010725.2-134s21c1
Sequence:CCGGTGATGCGAGTCAACGAGTCGTCTCGAGACGACTCGTTGACTCGCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010725.2-625s21c1
Sequence:CCGGAGAGCTTTCAAGGCATCCTTTCTCGAGAAAGGATGCCTTGAAAGCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010725.2-666s21c1
Sequence:CCGGTCGGAAGGTCCGAGAGACATTCTCGAGAATGTCTCTCGGACCTTCCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010725
LMX1B MISSION shRNA Lentiviral Transduction Particles
LIM homeobox transcription factor 1, beta
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000070593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010725.1-333s1c1
Sequence:CCGGTGTGTACCACTTGGGCTGTTTCTCGAGAAACAGCCCAAGTGGTACACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010725.1-252s1c1
Sequence:CCGGCCAACAGCTCTTCGCGGCAAACTCGAGTTTGCCGCGAAGAGCTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010725.1-417s1c1
Sequence:CCGGGCTGCTGTGCAAGGGTGACTACTCGAGTAGTCACCCTTGCACAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010725.1-544s1c1
Sequence:CCGGCAGAGTAAAGGCAGTGGAGATCTCGAGATCTCCACTGCCTTTACTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010725.2-134s21c1
Sequence:CCGGTGATGCGAGTCAACGAGTCGTCTCGAGACGACTCGTTGACTCGCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010725.2-625s21c1
Sequence:CCGGAGAGCTTTCAAGGCATCCTTTCTCGAGAAAGGATGCCTTGAAAGCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010725.2-666s21c1
Sequence:CCGGTCGGAAGGTCCGAGAGACATTCTCGAGAATGTCTCTCGGACCTTCCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002316
LMX1B MISSION shRNA Bacterial Glycerol Stock
LIM homeobox transcription factor 1, beta
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000017513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002316.1-223s1c1
Sequence:CCGGGATCGGAAACTGTACTGCAAACTCGAGTTTGCAGTACAGTTTCCGATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002316.1-126s1c1
Sequence:CCGGCCGCTTCCTGATGCGAGTCAACTCGAGTTGACTCGCATCAGGAAGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002316.1-378s1c1
Sequence:CCGGGCTACGCAAGGGCGACGAATTCTCGAGAATTCGTCGCCCTTGCGTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002316.1-957s1c1
Sequence:CCGGGCCAGGGAACGACTCCATCTTCTCGAGAAGATGGAGTCGTTCCCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002316.1-735s1c1
Sequence:CCGGGAACCAAAGAGCAAAGATGAACTCGAGTTCATCTTTGCTCTTTGGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002316.2-1140s21c1
Sequence:CCGGTCCATGCAGAGTTCCTACTTCCTCGAGGAAGTAGGAACTCTGCATGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002316.2-1036s21c1
Sequence:CCGGTCGACAGCGATACCTCCTTAACTCGAGTTAAGGAGGTATCGCTGTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002316.2-473s21c1
Sequence:CCGGGTGCAAGGGTGACTACGAGAACTCGAGTTCTCGTAGTCACCCTTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002316
LMX1B MISSION shRNA shRNA Plasmid DNA
LIM homeobox transcription factor 1, beta
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000017513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002316.1-223s1c1
Sequence:CCGGGATCGGAAACTGTACTGCAAACTCGAGTTTGCAGTACAGTTTCCGATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002316.1-126s1c1
Sequence:CCGGCCGCTTCCTGATGCGAGTCAACTCGAGTTGACTCGCATCAGGAAGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002316.1-378s1c1
Sequence:CCGGGCTACGCAAGGGCGACGAATTCTCGAGAATTCGTCGCCCTTGCGTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002316.1-957s1c1
Sequence:CCGGGCCAGGGAACGACTCCATCTTCTCGAGAAGATGGAGTCGTTCCCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002316.1-735s1c1
Sequence:CCGGGAACCAAAGAGCAAAGATGAACTCGAGTTCATCTTTGCTCTTTGGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002316.2-1140s21c1
Sequence:CCGGTCCATGCAGAGTTCCTACTTCCTCGAGGAAGTAGGAACTCTGCATGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002316.2-1036s21c1
Sequence:CCGGTCGACAGCGATACCTCCTTAACTCGAGTTAAGGAGGTATCGCTGTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002316.2-473s21c1
Sequence:CCGGGTGCAAGGGTGACTACGAGAACTCGAGTTCTCGTAGTCACCCTTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002316
LMX1B MISSION shRNA Lentiviral Transduction Particles
LIM homeobox transcription factor 1, beta
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000017513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002316.1-223s1c1
Sequence:CCGGGATCGGAAACTGTACTGCAAACTCGAGTTTGCAGTACAGTTTCCGATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002316.1-126s1c1
Sequence:CCGGCCGCTTCCTGATGCGAGTCAACTCGAGTTGACTCGCATCAGGAAGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002316.1-378s1c1
Sequence:CCGGGCTACGCAAGGGCGACGAATTCTCGAGAATTCGTCGCCCTTGCGTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002316.1-957s1c1
Sequence:CCGGGCCAGGGAACGACTCCATCTTCTCGAGAAGATGGAGTCGTTCCCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002316.1-735s1c1
Sequence:CCGGGAACCAAAGAGCAAAGATGAACTCGAGTTCATCTTTGCTCTTTGGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002316.2-1140s21c1
Sequence:CCGGTCCATGCAGAGTTCCTACTTCCTCGAGGAAGTAGGAACTCTGCATGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002316.2-1036s21c1
Sequence:CCGGTCGACAGCGATACCTCCTTAACTCGAGTTAAGGAGGTATCGCTGTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002316.2-473s21c1
Sequence:CCGGGTGCAAGGGTGACTACGAGAACTCGAGTTCTCGTAGTCACCCTTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks