EMAIL THIS PAGE TO A FRIEND

LNPEP

leucyl/cystinyl aminopeptidase

Synonyms: CAP IRAP P-LAP PLAP
Gene ID:
Human(4012) Summary: This gene encodes a zinc-dependent aminopeptidase that cleaves vasopressin, oxytocin, lys-bradykinin, met-enkephalin, dynorphin A and other peptide hormones. The protein can be secreted in maternal serum, reside in intracellular vesicles with the insulin-responsive glucose transporter GLUT4, or form a type II integral membrane glycoprotein. The protein catalyzes the final step in the conversion of angiotensinogen to angiotensin IV (AT4) and is also a receptor for AT4. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Mouse(240028) leucyl/cystinyl aminopeptidase
Rat(171105) leucyl/cystinyl aminopeptidase
Zebrafish(322814) leucyl/cystinyl aminopeptidase
dog(488896) leucyl/cystinyl aminopeptidase
Horse(100073222) leucyl/cystinyl aminopeptidase
cow(521633) leucyl/cystinyl aminopeptidase
domestic cat(101083321) leucyl/cystinyl aminopeptidase
chicken(427279) leucyl/cystinyl aminopeptidase
sheep(101102729) leucyl/cystinyl aminopeptidase
Domestic Rabbit(100353022) leucyl/cystinyl aminopeptidase
sheep(641307) leucyl/cystinyl aminopeptidase
domestic guinea pig(100718730) leucyl/cystinyl aminopeptidase
naked mole-rat(101709446) leucyl/cystinyl aminopeptidase
140 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005575 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005575 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005575 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172827 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172827 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172827 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005575 Rosetta Predictions human pricing
NM_175920 Rosetta Predictions human pricing
NM_001113403 Rosetta Predictions rat pricing
NM_133574 Rosetta Predictions rat pricing
NM_172827 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005575 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00055602 predicted 1484
2 SASI_Hs01_00055603 predicted 3022
3 SASI_Hs01_00055604 predicted 2066
4 SASI_Hs02_00339855 predicted 3018
5 SASI_Hs01_00055607 predicted 2826
6 SASI_Hs01_00055608 predicted 1506
7 SASI_Hs01_00055609 predicted 2250
8 SASI_Hs01_00055610 predicted 2636
9 SASI_Hs01_00055611 predicted 1813
10 SASI_Hs02_00339856 predicted 1747
11 SASI_Hs01_00055605 predicted 3696
12 SASI_Hs01_00055606 predicted 2545
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175920 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00241456 predicted 1279
2 SASI_Hs01_00241457 predicted 2812
3 SASI_Hs01_00241458 predicted 1851
4 SASI_Hs02_00369176 predicted 2808
5 SASI_Hs01_00241461 predicted 2625
6 SASI_Hs01_00241462 predicted 1303
7 SASI_Hs01_00241463 predicted 2041
8 SASI_Hs01_00241464 predicted 2437
9 SASI_Hs01_00241465 predicted 1597
10 SASI_Hs02_00369177 predicted 1534
11 SASI_Hs01_00241459 predicted 3486
12 SASI_Hs01_00241460 predicted 2330
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113403 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00251813 predicted 765
2 SASI_Rn02_00251814 predicted 1537
3 SASI_Rn02_00251815 predicted 2025
4 SASI_Rn02_00251816 predicted 266
5 SASI_Rn02_00251817 predicted 1799
6 SASI_Rn02_00251818 predicted 575
7 SASI_Rn02_00251819 predicted 2197
8 SASI_Rn02_00251820 predicted 2129
9 SASI_Rn02_00251821 predicted 2301
10 SASI_Rn02_00251822 predicted 871
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133574 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00031416 predicted 765
2 SASI_Rn01_00031417 predicted 1536
3 SASI_Rn01_00031418 predicted 2018
4 SASI_Rn02_00267769 predicted 266
5 SASI_Rn01_00031419 predicted 1807
6 SASI_Rn01_00031420 predicted 576
7 SASI_Rn01_00031421 predicted 2201
8 SASI_Rn02_00267770 predicted 2128
9 SASI_Rn01_00031422 predicted 2301
10 SASI_Rn01_00031423 predicted 872
11 SASI_Rn01_00031424 predicted 1600
12 SASI_Rn01_00031425 predicted 1922
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172827 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00045073 predicted 2165
2 SASI_Mm02_00344758 predicted 543
3 SASI_Mm01_00045075 predicted 2231
4 SASI_Mm01_00045076 predicted 2582
5 SASI_Mm01_00045078 predicted 1053
6 SASI_Mm01_00045079 predicted 3232
7 SASI_Mm01_00045080 predicted 278
8 SASI_Mm01_00045081 predicted 2947
9 SASI_Mm01_00045082 predicted 587
10 SASI_Mm02_00344759 predicted 2780
11 SASI_Mm01_00045074 predicted 773
12 SASI_Mm01_00045077 predicted 1818
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005575
VALIDATED
LNPEP MISSION shRNA Bacterial Glycerol Stock
leucyl/cystinyl aminopeptidase
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000307279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005575.2-611s21c1
Sequence:CCGGGAGCCTTGTTTACATCCTCTACTCGAGTAGAGGATGTAAACAAGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_005575.2-1140s21c1
Sequence:CCGGTTCATAGCACAGGTCATAATACTCGAGTATTATGACCTGTGCTATGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_005575.2-2883s21c1
Sequence:CCGGGACTGGTGACTAGGGTATTTACTCGAGTAAATACCCTAGTCACCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296805    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_005575.2-4020s21c1
Sequence:CCGGGCATTGGAATGTGGTACAAAGCTCGAGCTTTGTACCACATTCCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_005575.2-2045s21c1
Sequence:CCGGTTCTTAGATGCTCGATTTAAACTCGAGTTTAAATCGAGCATCTAAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005575.1-823s1c1
Sequence:CCGGGCACAATTATACGTTGAAGATCTCGAGATCTTCAACGTATAATTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_005575.1-1614s1c1
Sequence:CCGGCCATGAAGAAAGATTCCTTAACTCGAGTTAAGGAATCTTTCTTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005575.1-1038s1c1
Sequence:CCGGCCGCTTTATCAAATATGCCTACTCGAGTAGGCATATTTGATAAAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_005575.1-2365s1c1
Sequence:CCGGCCTGTTTCAGACAGACCTCATCTCGAGATGAGGTCTGTCTGAAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_005575.1-158s1c1
Sequence:CCGGGAGCCTTGTTTACATCCTCTACTCGAGTAGAGGATGTAAACAAGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005575
VALIDATED
LNPEP MISSION shRNA shRNA Plasmid DNA
leucyl/cystinyl aminopeptidase
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000307279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005575.2-611s21c1
Sequence:CCGGGAGCCTTGTTTACATCCTCTACTCGAGTAGAGGATGTAAACAAGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_005575.2-1140s21c1
Sequence:CCGGTTCATAGCACAGGTCATAATACTCGAGTATTATGACCTGTGCTATGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_005575.2-2883s21c1
Sequence:CCGGGACTGGTGACTAGGGTATTTACTCGAGTAAATACCCTAGTCACCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296805    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_005575.2-4020s21c1
Sequence:CCGGGCATTGGAATGTGGTACAAAGCTCGAGCTTTGTACCACATTCCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_005575.2-2045s21c1
Sequence:CCGGTTCTTAGATGCTCGATTTAAACTCGAGTTTAAATCGAGCATCTAAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005575.1-823s1c1
Sequence:CCGGGCACAATTATACGTTGAAGATCTCGAGATCTTCAACGTATAATTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_005575.1-1614s1c1
Sequence:CCGGCCATGAAGAAAGATTCCTTAACTCGAGTTAAGGAATCTTTCTTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005575.1-1038s1c1
Sequence:CCGGCCGCTTTATCAAATATGCCTACTCGAGTAGGCATATTTGATAAAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_005575.1-2365s1c1
Sequence:CCGGCCTGTTTCAGACAGACCTCATCTCGAGATGAGGTCTGTCTGAAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_005575.1-158s1c1
Sequence:CCGGGAGCCTTGTTTACATCCTCTACTCGAGTAGAGGATGTAAACAAGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005575
VALIDATED
LNPEP MISSION shRNA Lentiviral Transduction Particles
leucyl/cystinyl aminopeptidase
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000307279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005575.2-611s21c1
Sequence:CCGGGAGCCTTGTTTACATCCTCTACTCGAGTAGAGGATGTAAACAAGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_005575.2-1140s21c1
Sequence:CCGGTTCATAGCACAGGTCATAATACTCGAGTATTATGACCTGTGCTATGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_005575.2-2883s21c1
Sequence:CCGGGACTGGTGACTAGGGTATTTACTCGAGTAAATACCCTAGTCACCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296805    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_005575.2-4020s21c1
Sequence:CCGGGCATTGGAATGTGGTACAAAGCTCGAGCTTTGTACCACATTCCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_005575.2-2045s21c1
Sequence:CCGGTTCTTAGATGCTCGATTTAAACTCGAGTTTAAATCGAGCATCTAAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005575.1-823s1c1
Sequence:CCGGGCACAATTATACGTTGAAGATCTCGAGATCTTCAACGTATAATTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_005575.1-1614s1c1
Sequence:CCGGCCATGAAGAAAGATTCCTTAACTCGAGTTAAGGAATCTTTCTTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005575.1-1038s1c1
Sequence:CCGGCCGCTTTATCAAATATGCCTACTCGAGTAGGCATATTTGATAAAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_005575.1-2365s1c1
Sequence:CCGGCCTGTTTCAGACAGACCTCATCTCGAGATGAGGTCTGTCTGAAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_005575.1-158s1c1
Sequence:CCGGGAGCCTTGTTTACATCCTCTACTCGAGTAGAGGATGTAAACAAGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172827
VALIDATED
LNPEP MISSION shRNA Bacterial Glycerol Stock
leucyl/cystinyl aminopeptidase
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000031109    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172827.1-4727s1c1
Sequence:CCGGCCTGCTTTAATCCTAGAGTTTCTCGAGAAACTCTAGGATTAAAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031113    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172827.1-1822s1c1
Sequence:CCGGGCAGCTATCCAAAGTGATGATCTCGAGATCATCACTTTGGATAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172827.1-589s1c1
Sequence:CCGGGCCATTATTCCTCTATGCTATCTCGAGATAGCATAGAGGAATAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031110    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172827.1-1314s1c1
Sequence:CCGGCCCACTTAAGAAATTGGATTTCTCGAGAAATCCAATTTCTTAAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172827.1-2236s1c1
Sequence:CCGGCCTTATGTTCTGAGTGACAAACTCGAGTTTGTCACTCAGAACATAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172827
VALIDATED
LNPEP MISSION shRNA shRNA Plasmid DNA
leucyl/cystinyl aminopeptidase
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000031109    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172827.1-4727s1c1
Sequence:CCGGCCTGCTTTAATCCTAGAGTTTCTCGAGAAACTCTAGGATTAAAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031113    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172827.1-1822s1c1
Sequence:CCGGGCAGCTATCCAAAGTGATGATCTCGAGATCATCACTTTGGATAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172827.1-589s1c1
Sequence:CCGGGCCATTATTCCTCTATGCTATCTCGAGATAGCATAGAGGAATAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031110    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172827.1-1314s1c1
Sequence:CCGGCCCACTTAAGAAATTGGATTTCTCGAGAAATCCAATTTCTTAAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172827.1-2236s1c1
Sequence:CCGGCCTTATGTTCTGAGTGACAAACTCGAGTTTGTCACTCAGAACATAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172827
VALIDATED
LNPEP MISSION shRNA Lentiviral Transduction Particles
leucyl/cystinyl aminopeptidase
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000031109    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172827.1-4727s1c1
Sequence:CCGGCCTGCTTTAATCCTAGAGTTTCTCGAGAAACTCTAGGATTAAAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031113    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172827.1-1822s1c1
Sequence:CCGGGCAGCTATCCAAAGTGATGATCTCGAGATCATCACTTTGGATAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172827.1-589s1c1
Sequence:CCGGGCCATTATTCCTCTATGCTATCTCGAGATAGCATAGAGGAATAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031110    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172827.1-1314s1c1
Sequence:CCGGCCCACTTAAGAAATTGGATTTCTCGAGAAATCCAATTTCTTAAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172827.1-2236s1c1
Sequence:CCGGCCTTATGTTCTGAGTGACAAACTCGAGTTTGTCACTCAGAACATAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks