EMAIL THIS PAGE TO A FRIEND

LOC128192

Species: Human LOC128192(128192)
Gene ID:
31 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_060887 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_060887 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_060887 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001725191 Rosetta Predictions human pricing
XM_060887 Rosetta Predictions human pricing
XM_941423 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001725191 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00466152 predicted 249
2 SASI_Hs02_00466153 predicted 249
3 SASI_Hs02_00466154 predicted 260
4 SASI_Hs02_00466155 predicted 252
5 SASI_Hs02_00466156 predicted 245
6 SASI_Hs02_00466157 predicted 254
7 SASI_Hs02_00466158 predicted 248
8 SASI_Hs02_00466159 predicted 255
9 SASI_Hs02_00466160 predicted 242
10 SASI_Hs02_00466161 predicted 241
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_060887 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00248276 predicted 252
2 SASI_Hs01_00248277 predicted 249
3 SASI_Hs01_00248279 predicted 255
4 SASI_Hs01_00248280 predicted 251
5 SASI_Hs01_00248281 predicted 253
6 SASI_Hs01_00248282 predicted 245
7 SASI_Hs01_00248283 predicted 261
8 SASI_Hs01_00248284 predicted 247
9 SASI_Hs01_00248285 predicted 246
10 SASI_Hs02_00478713 predicted 236
11 SASI_Hs01_00248278 predicted 268
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_941423 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00484819 predicted 247
2 SASI_Hs02_00484820 predicted 249
3 SASI_Hs02_00484821 predicted 265
4 SASI_Hs02_00484822 predicted 255
5 SASI_Hs02_00484823 predicted 254
6 SASI_Hs02_00484824 predicted 258
7 SASI_Hs02_00484825 predicted 241
8 SASI_Hs02_00484826 predicted 257
9 SASI_Hs02_00484827 predicted 241
10 SASI_Hs02_00484828 predicted 241
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_060887
LOC128192 MISSION shRNA Bacterial Glycerol Stock
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000049438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_060887.3-109s1c1
Sequence:CCGGGCTCTGAGCAATGTAGAGAAACTCGAGTTTCTCTACATTGCTCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_060887.3-27s1c1
Sequence:CCGGCGCTGTCGACGGCAAGCCCTTCTCGAGAAGGGCTTGCCGTCGACAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_060887.3-270s1c1
Sequence:CCGGGCATACACATCCTGGCATCTTCTCGAGAAGATGCCAGGATGTGTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_060887.3-315s1c1
Sequence:CCGGCACAAATGGTTCCCAGTGTTTCTCGAGAAACACTGGGAACCATTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_060887.3-69s1c1
Sequence:CCGGGTTTGCAGACAAGGTTCCAAACTCGAGTTTGGAACCTTGTCTGCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_060887
LOC128192 MISSION shRNA shRNA Plasmid DNA
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000049438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_060887.3-109s1c1
Sequence:CCGGGCTCTGAGCAATGTAGAGAAACTCGAGTTTCTCTACATTGCTCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_060887.3-27s1c1
Sequence:CCGGCGCTGTCGACGGCAAGCCCTTCTCGAGAAGGGCTTGCCGTCGACAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_060887.3-270s1c1
Sequence:CCGGGCATACACATCCTGGCATCTTCTCGAGAAGATGCCAGGATGTGTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_060887.3-315s1c1
Sequence:CCGGCACAAATGGTTCCCAGTGTTTCTCGAGAAACACTGGGAACCATTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_060887.3-69s1c1
Sequence:CCGGGTTTGCAGACAAGGTTCCAAACTCGAGTTTGGAACCTTGTCTGCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_060887
LOC128192 MISSION shRNA Lentiviral Transduction Particles
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000049438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_060887.3-109s1c1
Sequence:CCGGGCTCTGAGCAATGTAGAGAAACTCGAGTTTCTCTACATTGCTCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_060887.3-27s1c1
Sequence:CCGGCGCTGTCGACGGCAAGCCCTTCTCGAGAAGGGCTTGCCGTCGACAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_060887.3-270s1c1
Sequence:CCGGGCATACACATCCTGGCATCTTCTCGAGAAGATGCCAGGATGTGTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_060887.3-315s1c1
Sequence:CCGGCACAAATGGTTCCCAGTGTTTCTCGAGAAACACTGGGAACCATTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_060887.3-69s1c1
Sequence:CCGGGTTTGCAGACAAGGTTCCAAACTCGAGTTTGGAACCTTGTCTGCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks