EMAIL THIS PAGE TO A FRIEND

LOC152586

Species: Human LOC152586(152586)
Gene ID:
52 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001034840 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001034840 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001034840 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001034840 Rosetta Predictions human pricing
XM_001720199 Rosetta Predictions human pricing
XM_001720248 Rosetta Predictions human pricing
XM_001725473 Rosetta Predictions human pricing
XM_929404 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034840 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00121821 predicted 3717
2 SASI_Hs01_00121822 predicted 3545
3 SASI_Hs01_00121823 predicted 3609
4 SASI_Hs01_00121824 predicted 3722
5 SASI_Hs01_00121825 predicted 3502
6 SASI_Hs01_00121826 predicted 3545
7 SASI_Hs01_00121827 predicted 3539
8 SASI_Hs01_00121828 predicted 3683
9 SASI_Hs01_00121829 predicted 3599
10 SASI_Hs01_00121830 predicted 3655
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001720199 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00435200 predicted 198
2 SASI_Hs02_00435201 predicted 564
3 SASI_Hs02_00435202 predicted 201
4 SASI_Hs02_00435203 predicted 388
5 SASI_Hs02_00435204 predicted 377
6 SASI_Hs02_00435205 predicted 326
7 SASI_Hs02_00435206 predicted 479
8 SASI_Hs02_00435207 predicted 208
9 SASI_Hs02_00435208 predicted 441
10 SASI_Hs02_00435209 predicted 446
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001720248 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00435523 predicted 200
2 SASI_Hs02_00435524 predicted 559
3 SASI_Hs02_00435525 predicted 196
4 SASI_Hs02_00435526 predicted 390
5 SASI_Hs02_00435527 predicted 383
6 SASI_Hs02_00435528 predicted 329
7 SASI_Hs02_00435529 predicted 487
8 SASI_Hs02_00435530 predicted 203
9 SASI_Hs02_00435531 predicted 440
10 SASI_Hs02_00435532 predicted 446
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001725473 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00467979 predicted 196
2 SASI_Hs02_00467980 predicted 566
3 SASI_Hs02_00467981 predicted 202
4 SASI_Hs02_00467982 predicted 383
5 SASI_Hs02_00467983 predicted 377
6 SASI_Hs02_00467984 predicted 328
7 SASI_Hs02_00467985 predicted 486
8 SASI_Hs02_00467986 predicted 209
9 SASI_Hs02_00467987 predicted 438
10 SASI_Hs02_00467988 predicted 439
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_929404 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00269771 predicted 500
2 SASI_Hs01_00269772 predicted 674
3 SASI_Hs01_00269773 predicted 274
4 SASI_Hs01_00269774 predicted 638
5 SASI_Hs01_00269775 predicted 348
6 SASI_Hs01_00269776 predicted 229
7 SASI_Hs01_00269777 predicted 282
8 SASI_Hs01_00269778 predicted 586
9 SASI_Hs01_00269779 predicted 639
10 SASI_Hs01_00269780 predicted 497
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001034840
LOC152586 MISSION shRNA Bacterial Glycerol Stock
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000150150    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001034840.1-3586s1c1
Sequence:CCGGGTTCTACAAAGAGAAACCCATCTCGAGATGGGTTTCTCTTTGTAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001034840.1-3556s1c1
Sequence:CCGGCTTAACTCACTTTGTACGGTTCTCGAGAACCGTACAAAGTGAGTTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146392    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001034840.1-3649s1c1
Sequence:CCGGCGCAGGAGAAGATCTTAGAAACTCGAGTTTCTAAGATCTTCTCCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001034840.1-3539s1c1
Sequence:CCGGCTGTTTAGATCTGAGGACTTACTCGAGTAAGTCCTCAGATCTAAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001034840.1-3589s1c1
Sequence:CCGGCTACAAAGAGAAACCCATAGACTCGAGTCTATGGGTTTCTCTTTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001034840.1-3528s1c1
Sequence:CCGGCCATAGGAAAGCTGTTTAGATCTCGAGATCTAAACAGCTTTCCTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001034840.1-3551s1c1
Sequence:CCGGGAGGACTTAACTCACTTTGTACTCGAGTACAAAGTGAGTTAAGTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001034840
LOC152586 MISSION shRNA shRNA Plasmid DNA
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000150150    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001034840.1-3586s1c1
Sequence:CCGGGTTCTACAAAGAGAAACCCATCTCGAGATGGGTTTCTCTTTGTAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001034840.1-3556s1c1
Sequence:CCGGCTTAACTCACTTTGTACGGTTCTCGAGAACCGTACAAAGTGAGTTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146392    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001034840.1-3649s1c1
Sequence:CCGGCGCAGGAGAAGATCTTAGAAACTCGAGTTTCTAAGATCTTCTCCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001034840.1-3539s1c1
Sequence:CCGGCTGTTTAGATCTGAGGACTTACTCGAGTAAGTCCTCAGATCTAAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001034840.1-3589s1c1
Sequence:CCGGCTACAAAGAGAAACCCATAGACTCGAGTCTATGGGTTTCTCTTTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001034840.1-3528s1c1
Sequence:CCGGCCATAGGAAAGCTGTTTAGATCTCGAGATCTAAACAGCTTTCCTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001034840.1-3551s1c1
Sequence:CCGGGAGGACTTAACTCACTTTGTACTCGAGTACAAAGTGAGTTAAGTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001034840
LOC152586 MISSION shRNA Lentiviral Transduction Particles
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000150150    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001034840.1-3586s1c1
Sequence:CCGGGTTCTACAAAGAGAAACCCATCTCGAGATGGGTTTCTCTTTGTAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001034840.1-3556s1c1
Sequence:CCGGCTTAACTCACTTTGTACGGTTCTCGAGAACCGTACAAAGTGAGTTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146392    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001034840.1-3649s1c1
Sequence:CCGGCGCAGGAGAAGATCTTAGAAACTCGAGTTTCTAAGATCTTCTCCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001034840.1-3539s1c1
Sequence:CCGGCTGTTTAGATCTGAGGACTTACTCGAGTAAGTCCTCAGATCTAAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001034840.1-3589s1c1
Sequence:CCGGCTACAAAGAGAAACCCATAGACTCGAGTCTATGGGTTTCTCTTTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001034840.1-3528s1c1
Sequence:CCGGCCATAGGAAAGCTGTTTAGATCTCGAGATCTAAACAGCTTTCCTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001034840.1-3551s1c1
Sequence:CCGGGAGGACTTAACTCACTTTGTACTCGAGTACAAAGTGAGTTAAGTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks