EMAIL THIS PAGE TO A FRIEND

LOC220729

Species: Human LOC220729(220729)
Gene ID:
32 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_049575 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_049575 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_049575 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NR_003266 Rosetta Predictions human pricing
XM_927048 Rosetta Predictions human pricing
XM_931786 Rosetta Predictions human pricing
XR_042153 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_003266 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00379032 predicted 4490
2 SASI_Hs02_00379033 predicted 4289
3 SASI_Hs02_00379034 predicted 3849
4 SASI_Hs02_00379035 predicted 5923
5 SASI_Hs02_00379036 predicted 4269
6 SASI_Hs02_00379037 predicted 3422
7 SASI_Hs02_00379038 predicted 1232
8 SASI_Hs02_00379039 predicted 3873
9 SASI_Hs02_00379040 predicted 1146
10 SASI_Hs02_00379041 predicted 928
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_927048 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00272875 predicted 679
2 SASI_Hs01_00272876 predicted 681
3 SASI_Hs01_00272877 predicted 848
4 SASI_Hs01_00272878 predicted 850
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_931786 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00291066 predicted 479
2 SASI_Hs01_00291067 predicted 475
3 SASI_Hs01_00291068 predicted 640
4 SASI_Hs01_00291069 predicted 644
5 SASI_Hs01_00291070 predicted 2321
6 SASI_Hs01_00291071 predicted 2307
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_042153 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00533460 predicted 367
2 SASI_Hs02_00533461 predicted 747
3 SASI_Hs02_00533462 predicted 412
4 SASI_Hs02_00533463 predicted 280
5 SASI_Hs02_00533464 predicted 261
6 SASI_Hs02_00533465 predicted 281
7 SASI_Hs02_00533466 predicted 1075
8 SASI_Hs02_00533467 predicted 1041
9 SASI_Hs02_00533468 predicted 139
10 SASI_Hs02_00533469 predicted 1055
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_049575
LOC220729 MISSION shRNA Bacterial Glycerol Stock
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000028122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_049575.11-968s1c1
Sequence:CCGGTGTTGTTGCCACAGGAGTCAACTCGAGTTGACTCCTGTGGCAACAACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_049575.11-976s1c1
Sequence:CCGGCCACAGGAGTCAAGAAACTTTCTCGAGAAAGTTTCTTGACTCCTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_049575.11-697s1c1
Sequence:CCGGGAACTGAAGATGGGAAGATTTCTCGAGAAATCTTCCCATCTTCAGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_049575.11-839s1c1
Sequence:CCGGGAGATATGATACCAGCTGTTTCTCGAGAAACAGCTGGTATCATATCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_049575.11-944s1c1
Sequence:CCGGCCATCACATAAGAGCAAAGAACTCGAGTTCTTTGCTCTTATGTGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_049575
LOC220729 MISSION shRNA shRNA Plasmid DNA
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000028122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_049575.11-968s1c1
Sequence:CCGGTGTTGTTGCCACAGGAGTCAACTCGAGTTGACTCCTGTGGCAACAACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_049575.11-976s1c1
Sequence:CCGGCCACAGGAGTCAAGAAACTTTCTCGAGAAAGTTTCTTGACTCCTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_049575.11-697s1c1
Sequence:CCGGGAACTGAAGATGGGAAGATTTCTCGAGAAATCTTCCCATCTTCAGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_049575.11-839s1c1
Sequence:CCGGGAGATATGATACCAGCTGTTTCTCGAGAAACAGCTGGTATCATATCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_049575.11-944s1c1
Sequence:CCGGCCATCACATAAGAGCAAAGAACTCGAGTTCTTTGCTCTTATGTGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_049575
LOC220729 MISSION shRNA Lentiviral Transduction Particles
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000028122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_049575.11-968s1c1
Sequence:CCGGTGTTGTTGCCACAGGAGTCAACTCGAGTTGACTCCTGTGGCAACAACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_049575.11-976s1c1
Sequence:CCGGCCACAGGAGTCAAGAAACTTTCTCGAGAAAGTTTCTTGACTCCTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_049575.11-697s1c1
Sequence:CCGGGAACTGAAGATGGGAAGATTTCTCGAGAAATCTTCCCATCTTCAGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_049575.11-839s1c1
Sequence:CCGGGAGATATGATACCAGCTGTTTCTCGAGAAACAGCTGGTATCATATCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_049575.11-944s1c1
Sequence:CCGGCCATCACATAAGAGCAAAGAACTCGAGTTCTTTGCTCTTATGTGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks