EMAIL THIS PAGE TO A FRIEND

LOC388022

Species: Human LOC388022(388022)
Gene ID:
9 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001013637 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001013637 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001013637 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001013637 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013637 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00226550 predicted 1480
2 SASI_Hs01_00226551 predicted 663
3 SASI_Hs01_00226552 predicted 630
4 SASI_Hs01_00226553 predicted 643
5 SASI_Hs01_00226554 predicted 729
6 SASI_Hs01_00226555 predicted 1182
7 SASI_Hs01_00226556 predicted 1325
8 SASI_Hs01_00226557 predicted 1243
9 SASI_Hs01_00226558 predicted 345
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001013637
LOC388022 MISSION shRNA Bacterial Glycerol Stock
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166634    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013637.1-1874s1c1
Sequence:CCGGCTTAGTGAGGTGGTCTAGCATCTCGAGATGCTAGACCACCTCACTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160696    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013637.1-1054s1c1
Sequence:CCGGCGACACGCTAAGTTTATGTTTCTCGAGAAACATAAACTTAGCGTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163725    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013637.1-1053s1c1
Sequence:CCGGGCGACACGCTAAGTTTATGTTCTCGAGAACATAAACTTAGCGTGTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165983    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013637.1-1912s1c1
Sequence:CCGGGCCTCTATCTGACATCTGCTACTCGAGTAGCAGATGTCAGATAGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164679    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013637.1-1908s1c1
Sequence:CCGGCCAAGCCTCTATCTGACATCTCTCGAGAGATGTCAGATAGAGGCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001013637
LOC388022 MISSION shRNA shRNA Plasmid DNA
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166634    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013637.1-1874s1c1
Sequence:CCGGCTTAGTGAGGTGGTCTAGCATCTCGAGATGCTAGACCACCTCACTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160696    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013637.1-1054s1c1
Sequence:CCGGCGACACGCTAAGTTTATGTTTCTCGAGAAACATAAACTTAGCGTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163725    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013637.1-1053s1c1
Sequence:CCGGGCGACACGCTAAGTTTATGTTCTCGAGAACATAAACTTAGCGTGTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165983    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013637.1-1912s1c1
Sequence:CCGGGCCTCTATCTGACATCTGCTACTCGAGTAGCAGATGTCAGATAGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164679    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013637.1-1908s1c1
Sequence:CCGGCCAAGCCTCTATCTGACATCTCTCGAGAGATGTCAGATAGAGGCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001013637
LOC388022 MISSION shRNA Lentiviral Transduction Particles
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166634    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013637.1-1874s1c1
Sequence:CCGGCTTAGTGAGGTGGTCTAGCATCTCGAGATGCTAGACCACCTCACTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160696    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013637.1-1054s1c1
Sequence:CCGGCGACACGCTAAGTTTATGTTTCTCGAGAAACATAAACTTAGCGTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163725    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013637.1-1053s1c1
Sequence:CCGGGCGACACGCTAAGTTTATGTTCTCGAGAACATAAACTTAGCGTGTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165983    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013637.1-1912s1c1
Sequence:CCGGGCCTCTATCTGACATCTGCTACTCGAGTAGCAGATGTCAGATAGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164679    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013637.1-1908s1c1
Sequence:CCGGCCAAGCCTCTATCTGACATCTCTCGAGAGATGTCAGATAGAGGCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks