EMAIL THIS PAGE TO A FRIEND

LOC390937

Species: Human LOC390937(390937)
Gene ID:
30 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_001717702 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_001717702 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_001717702 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001717702 Rosetta Predictions human pricing
XM_372730 Rosetta Predictions human pricing
XM_940847 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001717702 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00418842 predicted 486
2 SASI_Hs02_00418843 predicted 549
3 SASI_Hs02_00418844 predicted 365
4 SASI_Hs02_00418845 predicted 295
5 SASI_Hs02_00418846 predicted 362
6 SASI_Hs02_00418847 predicted 340
7 SASI_Hs02_00418848 predicted 334
8 SASI_Hs02_00418849 predicted 318
9 SASI_Hs02_00418850 predicted 552
10 SASI_Hs02_00418851 predicted 315
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_372730 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00251143 predicted 736
2 SASI_Hs01_00251144 predicted 540
3 SASI_Hs01_00251145 predicted 584
4 SASI_Hs01_00251146 predicted 568
5 SASI_Hs01_00251147 predicted 801
6 SASI_Hs01_00251148 predicted 564
7 SASI_Hs01_00251149 predicted 1217
8 SASI_Hs01_00251150 predicted 60
9 SASI_Hs01_00251151 predicted 168
10 SASI_Hs01_00251152 predicted 822
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_940847 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00484429 predicted 740
2 SASI_Hs02_00484430 predicted 806
3 SASI_Hs02_00484431 predicted 623
4 SASI_Hs02_00484432 predicted 544
5 SASI_Hs02_00484433 predicted 615
6 SASI_Hs02_00484434 predicted 589
7 SASI_Hs02_00484435 predicted 584
8 SASI_Hs02_00484436 predicted 567
9 SASI_Hs02_00484437 predicted 809
10 SASI_Hs02_00484438 predicted 570
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_001717702
LOC390937 MISSION shRNA Bacterial Glycerol Stock
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000230949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001717702.1-306s21c1
Sequence:CCGGCTACTACAACAAGCGGATTCTCTCGAGAGAATCCGCTTGTTGTAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001717702.1-339s21c1
Sequence:CCGGAGGGAAGAGGTTCACCTACAACTCGAGTTGTAGGTGAACCTCTTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001717702.1-615s21c1
Sequence:CCGGTGGTGCCACCAGCTATTCCAACTCGAGTTGGAATAGCTGGTGGCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217988    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001717702.1-372s21c1
Sequence:GTACCGGCAAAGTCGTGCTTGTCAATTACTCGAGTAATTGACAAGCACGACTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001717702.1-560s21c1
Sequence:CCGGTCACCTCCGAGACAGATAAATCTCGAGATTTATCTGTCTCGGAGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_001717702
LOC390937 MISSION shRNA shRNA Plasmid DNA
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000230949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001717702.1-306s21c1
Sequence:CCGGCTACTACAACAAGCGGATTCTCTCGAGAGAATCCGCTTGTTGTAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001717702.1-339s21c1
Sequence:CCGGAGGGAAGAGGTTCACCTACAACTCGAGTTGTAGGTGAACCTCTTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001717702.1-615s21c1
Sequence:CCGGTGGTGCCACCAGCTATTCCAACTCGAGTTGGAATAGCTGGTGGCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217988    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001717702.1-372s21c1
Sequence:GTACCGGCAAAGTCGTGCTTGTCAATTACTCGAGTAATTGACAAGCACGACTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001717702.1-560s21c1
Sequence:CCGGTCACCTCCGAGACAGATAAATCTCGAGATTTATCTGTCTCGGAGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_001717702
LOC390937 MISSION shRNA Lentiviral Transduction Particles
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000230949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001717702.1-306s21c1
Sequence:CCGGCTACTACAACAAGCGGATTCTCTCGAGAGAATCCGCTTGTTGTAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001717702.1-339s21c1
Sequence:CCGGAGGGAAGAGGTTCACCTACAACTCGAGTTGTAGGTGAACCTCTTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001717702.1-615s21c1
Sequence:CCGGTGGTGCCACCAGCTATTCCAACTCGAGTTGGAATAGCTGGTGGCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217988    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001717702.1-372s21c1
Sequence:GTACCGGCAAAGTCGTGCTTGTCAATTACTCGAGTAATTGACAAGCACGACTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001717702.1-560s21c1
Sequence:CCGGTCACCTCCGAGACAGATAAATCTCGAGATTTATCTGTCTCGGAGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks