EMAIL THIS PAGE TO A FRIEND

LOC391707

Species: Human LOC391707(391707)
Gene ID:
Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_373036
LOC391707 MISSION shRNA Bacterial Glycerol Stock
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000053094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_373036.1-221s1c1
Sequence:CCGGCCAAGGCAATGGAACTCTGTTCTCGAGAACAGAGTTCCATTGCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_373036.1-302s1c1
Sequence:CCGGCTGACAGCGATTTAGCAAATACTCGAGTATTTGCTAAATCGCTGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_373036.1-92s1c1
Sequence:CCGGGAGGTGGTCATGGGCAAAGAACTCGAGTTCTTTGCCCATGACCACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_373036.1-226s1c1
Sequence:CCGGGCAATGGAACTCTGTTCAATACTCGAGTATTGAACAGAGTTCCATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_373036
LOC391707 MISSION shRNA shRNA Plasmid DNA
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000053094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_373036.1-221s1c1
Sequence:CCGGCCAAGGCAATGGAACTCTGTTCTCGAGAACAGAGTTCCATTGCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_373036.1-302s1c1
Sequence:CCGGCTGACAGCGATTTAGCAAATACTCGAGTATTTGCTAAATCGCTGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_373036.1-92s1c1
Sequence:CCGGGAGGTGGTCATGGGCAAAGAACTCGAGTTCTTTGCCCATGACCACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_373036.1-226s1c1
Sequence:CCGGGCAATGGAACTCTGTTCAATACTCGAGTATTGAACAGAGTTCCATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_373036
LOC391707 MISSION shRNA Lentiviral Transduction Particles
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000053094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_373036.1-221s1c1
Sequence:CCGGCCAAGGCAATGGAACTCTGTTCTCGAGAACAGAGTTCCATTGCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_373036.1-302s1c1
Sequence:CCGGCTGACAGCGATTTAGCAAATACTCGAGTATTTGCTAAATCGCTGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_373036.1-92s1c1
Sequence:CCGGGAGGTGGTCATGGGCAAAGAACTCGAGTTCTTTGCCCATGACCACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_373036.1-226s1c1
Sequence:CCGGGCAATGGAACTCTGTTCAATACTCGAGTATTGAACAGAGTTCCATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks