EMAIL THIS PAGE TO A FRIEND

LOC402644

Species: Human LOC402644(402644)
Gene ID:
10 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_379998 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_379998 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_379998 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_377934 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_377934 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_377934 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001126493 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001126493 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001126493 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001126493 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001126493 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00328507 predicted 243
2 SASI_Hs02_00328508 predicted 251
3 SASI_Hs02_00328509 predicted 249
4 SASI_Hs02_00328510 predicted 154
5 SASI_Hs02_00328511 predicted 162
6 SASI_Hs02_00328512 predicted 5
7 SASI_Hs02_00328513 predicted 416
8 SASI_Hs02_00328514 predicted 187
9 SASI_Hs02_00328515 predicted 376
10 SASI_Hs02_00328516 predicted 191
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_379998
VALIDATED
LOC402644 MISSION shRNA Bacterial Glycerol Stock
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000049258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:XM_379998.1-122s1c1
Sequence:CCGGCTGAAGAGAAAGGATTTGGTTCTCGAGAACCAAATCCTTTCTCTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_379998.1-192s1c1
Sequence:CCGGTGGTGACTTCACGCACCATAACTCGAGTTATGGTGCGTGAAGTCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_379998.1-46s1c1
Sequence:CCGGCCCTTGGACCACGTCTCCTTTCTCGAGAAAGGAGACGTGGTCCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:XM_379998.1-83s1c1
Sequence:CCGGAGTTTCCAAAGACAGCAGAAACTCGAGTTTCTGCTGTCTTTGGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:XM_379998.1-172s1c1
Sequence:CCGGCCAGCATTTATGTGTCAGGGTCTCGAGACCCTGACACATAAATGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_379998
VALIDATED
LOC402644 MISSION shRNA shRNA Plasmid DNA
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000049258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:XM_379998.1-122s1c1
Sequence:CCGGCTGAAGAGAAAGGATTTGGTTCTCGAGAACCAAATCCTTTCTCTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_379998.1-192s1c1
Sequence:CCGGTGGTGACTTCACGCACCATAACTCGAGTTATGGTGCGTGAAGTCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_379998.1-46s1c1
Sequence:CCGGCCCTTGGACCACGTCTCCTTTCTCGAGAAAGGAGACGTGGTCCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:XM_379998.1-83s1c1
Sequence:CCGGAGTTTCCAAAGACAGCAGAAACTCGAGTTTCTGCTGTCTTTGGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:XM_379998.1-172s1c1
Sequence:CCGGCCAGCATTTATGTGTCAGGGTCTCGAGACCCTGACACATAAATGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_379998
VALIDATED
LOC402644 MISSION shRNA Lentiviral Transduction Particles
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000049258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:XM_379998.1-122s1c1
Sequence:CCGGCTGAAGAGAAAGGATTTGGTTCTCGAGAACCAAATCCTTTCTCTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_379998.1-192s1c1
Sequence:CCGGTGGTGACTTCACGCACCATAACTCGAGTTATGGTGCGTGAAGTCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_379998.1-46s1c1
Sequence:CCGGCCCTTGGACCACGTCTCCTTTCTCGAGAAAGGAGACGTGGTCCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:XM_379998.1-83s1c1
Sequence:CCGGAGTTTCCAAAGACAGCAGAAACTCGAGTTTCTGCTGTCTTTGGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:XM_379998.1-172s1c1
Sequence:CCGGCCAGCATTTATGTGTCAGGGTCTCGAGACCCTGACACATAAATGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_377934
VALIDATED
LOC402644 MISSION shRNA Bacterial Glycerol Stock
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000049247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_377934.1-55s1c1
Sequence:CCGGCACGTCTCCTTTGAGCTGTTTCTCGAGAAACAGCTCAAAGGAGACGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_377934.1-297s1c1
Sequence:CCGGCATGGCAAATTCTGGACCCAACTCGAGTTGGGTCCAGAATTTGCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_377934.1-160s1c1
Sequence:CCGGCACAGAATTATACCAGCATTTCTCGAGAAATGCTGGTATAATTCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_377934.1-313s1c1
Sequence:CCGGCCCAACACAAACTGTTCCGTTCTCGAGAACGGAACAGTTTGTGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:XM_377934.1-151s1c1
Sequence:CCGGCCCTGCTTTCACAGAATTATACTCGAGTATAATTCTGTGAAAGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_377934
VALIDATED
LOC402644 MISSION shRNA shRNA Plasmid DNA
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000049247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_377934.1-55s1c1
Sequence:CCGGCACGTCTCCTTTGAGCTGTTTCTCGAGAAACAGCTCAAAGGAGACGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_377934.1-297s1c1
Sequence:CCGGCATGGCAAATTCTGGACCCAACTCGAGTTGGGTCCAGAATTTGCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_377934.1-160s1c1
Sequence:CCGGCACAGAATTATACCAGCATTTCTCGAGAAATGCTGGTATAATTCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_377934.1-313s1c1
Sequence:CCGGCCCAACACAAACTGTTCCGTTCTCGAGAACGGAACAGTTTGTGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:XM_377934.1-151s1c1
Sequence:CCGGCCCTGCTTTCACAGAATTATACTCGAGTATAATTCTGTGAAAGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_377934
VALIDATED
LOC402644 MISSION shRNA Lentiviral Transduction Particles
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000049247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_377934.1-55s1c1
Sequence:CCGGCACGTCTCCTTTGAGCTGTTTCTCGAGAAACAGCTCAAAGGAGACGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_377934.1-297s1c1
Sequence:CCGGCATGGCAAATTCTGGACCCAACTCGAGTTGGGTCCAGAATTTGCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_377934.1-160s1c1
Sequence:CCGGCACAGAATTATACCAGCATTTCTCGAGAAATGCTGGTATAATTCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_377934.1-313s1c1
Sequence:CCGGCCCAACACAAACTGTTCCGTTCTCGAGAACGGAACAGTTTGTGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:XM_377934.1-151s1c1
Sequence:CCGGCCCTGCTTTCACAGAATTATACTCGAGTATAATTCTGTGAAAGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001126493
LOC402644 MISSION shRNA Bacterial Glycerol Stock
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000370864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001126493.1-216s21c1
Sequence:CCGGCACTGGTGGCAAGTCCATCTACTCGAGTAGATGGACTTGCCACCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001126493.1-288s21c1
Sequence:CCGGCATCTTGTCCATGGCAAATTCCTCGAGGAATTTGCCATGGACAAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001126493.1-56s21c1
Sequence:CCGGACGTCTCCTTTGAGCTGTTTGCTCGAGCAAACAGCTCAAAGGAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001126493.1-193s21c1
Sequence:CCGGGGTGACTTCACGCACCATAATCTCGAGATTATGGTGCGTGAAGTCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001126493.1-275s21c1
Sequence:CCGGGTACAGGTCCTGGCATCTTGTCTCGAGACAAGATGCCAGGACCTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001126493.1-140s21c1
Sequence:CCGGGTTATAAGGGTCCCTGCTTTCCTCGAGGAAAGCAGGGACCCTTATAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001126493
LOC402644 MISSION shRNA shRNA Plasmid DNA
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000370864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001126493.1-216s21c1
Sequence:CCGGCACTGGTGGCAAGTCCATCTACTCGAGTAGATGGACTTGCCACCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001126493.1-288s21c1
Sequence:CCGGCATCTTGTCCATGGCAAATTCCTCGAGGAATTTGCCATGGACAAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001126493.1-56s21c1
Sequence:CCGGACGTCTCCTTTGAGCTGTTTGCTCGAGCAAACAGCTCAAAGGAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001126493.1-193s21c1
Sequence:CCGGGGTGACTTCACGCACCATAATCTCGAGATTATGGTGCGTGAAGTCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001126493.1-275s21c1
Sequence:CCGGGTACAGGTCCTGGCATCTTGTCTCGAGACAAGATGCCAGGACCTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001126493.1-140s21c1
Sequence:CCGGGTTATAAGGGTCCCTGCTTTCCTCGAGGAAAGCAGGGACCCTTATAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001126493
LOC402644 MISSION shRNA Lentiviral Transduction Particles
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000370864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001126493.1-216s21c1
Sequence:CCGGCACTGGTGGCAAGTCCATCTACTCGAGTAGATGGACTTGCCACCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001126493.1-288s21c1
Sequence:CCGGCATCTTGTCCATGGCAAATTCCTCGAGGAATTTGCCATGGACAAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001126493.1-56s21c1
Sequence:CCGGACGTCTCCTTTGAGCTGTTTGCTCGAGCAAACAGCTCAAAGGAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001126493.1-193s21c1
Sequence:CCGGGGTGACTTCACGCACCATAATCTCGAGATTATGGTGCGTGAAGTCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001126493.1-275s21c1
Sequence:CCGGGTACAGGTCCTGGCATCTTGTCTCGAGACAAGATGCCAGGACCTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001126493.1-140s21c1
Sequence:CCGGGTTATAAGGGTCCCTGCTTTCCTCGAGGAAAGCAGGGACCCTTATAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks