EMAIL THIS PAGE TO A FRIEND

LONP2

lon peptidase 2, peroxisomal

Synonyms: LONP LONPL
UniProtKB ID: Q86WA8, Q0D2H6, Q8N3B9, Q8NCE9, Q96K43
Gene ID:
Mouse(66887) lon peptidase 2, peroxisomal
Rat(291922) lon peptidase 2, peroxisomal
domestic guinea pig(100716541) lon peptidase 2, peroxisomal
naked mole-rat(101701524) lon peptidase 2, peroxisomal
sheep(101110861) lon peptidase 2, peroxisomal
Zebrafish(494030) lon peptidase 2, peroxisomal
cow(541085) lon peptidase 2, peroxisomal
Horse(100057497) lon peptidase 2, peroxisomal
domestic cat(101090065) lon peptidase 2, peroxisomal
dog(478137) lon peptidase 2, peroxisomal
chicken(415740) lon peptidase 2, peroxisomal
51 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_031490 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031490 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031490 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025827 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025827 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025827 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_031490 Rosetta Predictions human pricing
NM_001033689 Rosetta Predictions rat pricing
NM_025827 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031490 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00142611 predicted 1728
2 SASI_Hs01_00142612 predicted 376
3 SASI_Hs02_00358926 predicted 2523
4 SASI_Hs01_00142614 predicted 2050
5 SASI_Hs01_00142615 predicted 1767
6 SASI_Hs01_00142616 predicted 1393
7 SASI_Hs01_00142617 predicted 1075
8 SASI_Hs02_00358927 predicted 1845
9 SASI_Hs01_00142618 predicted 821
10 SASI_Hs02_00358928 predicted 2003
11 SASI_Hs01_00142613 predicted 1608
12 SASI_Hs01_00142619 predicted 943
13 SASI_Hs01_00142620 predicted 1301
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033689 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00203702 predicted 585
2 SASI_Rn02_00203703 predicted 329
3 SASI_Rn02_00203704 predicted 1772
4 SASI_Rn02_00203705 predicted 476
5 SASI_Rn02_00203706 predicted 1010
6 SASI_Rn02_00203707 predicted 654
7 SASI_Rn02_00203708 predicted 806
8 SASI_Rn02_00203709 predicted 1289
9 SASI_Rn02_00203710 predicted 1023
10 SASI_Rn02_00203711 predicted 540
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025827 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00071675 predicted 2167
2 SASI_Mm01_00071676 predicted 1387
3 SASI_Mm01_00071677 predicted 2083
4 SASI_Mm01_00071678 predicted 1474
5 SASI_Mm01_00071679 predicted 716
6 SASI_Mm01_00071680 predicted 1342
7 SASI_Mm01_00071682 predicted 356
8 SASI_Mm01_00071683 predicted 993
9 SASI_Mm01_00071684 predicted 978
10 SASI_Mm02_00329091 predicted 393
11 SASI_Mm01_00071681 predicted 729
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031490
VALIDATED
LONP2 MISSION shRNA Bacterial Glycerol Stock
lon peptidase 2, peroxisomal
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000046828    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031490.2-3174s1c1
Sequence:CCGGGCCAACTATTCTTGGCTATATCTCGAGATATAGCCAAGAATAGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_031490.2-990s1c1
Sequence:CCGGCCTCAGTCAATGCCAGAATATCTCGAGATATTCTGGCATTGACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_031490.2-2048s1c1
Sequence:CCGGGCCAGGAGTAGCAATAGGTTTCTCGAGAAACCTATTGCTACTCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_031490.2-735s1c1
Sequence:CCGGCCACTGCTTGTCAGACAAATTCTCGAGAATTTGTCTGACAAGCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_031490.2-376s1c1
Sequence:CCGGCCCACTACACTCTGTTGATTACTCGAGTAATCAACAGAGTGTAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031490.2-2527s21c1
Sequence:CCGGGCAACGTACGACAGGATTTAACTCGAGTTAAATCCTGTCGTACGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031490.2-933s21c1
Sequence:CCGGATGCCAGAGCAGGCCCATAAACTCGAGTTTATGGGCCTGCTCTGGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414064    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031490.2-3088s21c1
Sequence:CCGGACCATTACCTTAGTGGATTTACTCGAGTAAATCCACTAAGGTAATGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031490.2-1494s21c1
Sequence:CCGGCATAACTTCACAGATCATTATCTCGAGATAATGATCTGTGAAGTTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031490.2-413s21c1
Sequence:CCGGCCAGATTGTACAGGTCTTAAACTCGAGTTTAAGACCTGTACAATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031490
VALIDATED
LONP2 MISSION shRNA shRNA Plasmid DNA
lon peptidase 2, peroxisomal
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000046828    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031490.2-3174s1c1
Sequence:CCGGGCCAACTATTCTTGGCTATATCTCGAGATATAGCCAAGAATAGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_031490.2-990s1c1
Sequence:CCGGCCTCAGTCAATGCCAGAATATCTCGAGATATTCTGGCATTGACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_031490.2-2048s1c1
Sequence:CCGGGCCAGGAGTAGCAATAGGTTTCTCGAGAAACCTATTGCTACTCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_031490.2-735s1c1
Sequence:CCGGCCACTGCTTGTCAGACAAATTCTCGAGAATTTGTCTGACAAGCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_031490.2-376s1c1
Sequence:CCGGCCCACTACACTCTGTTGATTACTCGAGTAATCAACAGAGTGTAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031490.2-2527s21c1
Sequence:CCGGGCAACGTACGACAGGATTTAACTCGAGTTAAATCCTGTCGTACGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031490.2-933s21c1
Sequence:CCGGATGCCAGAGCAGGCCCATAAACTCGAGTTTATGGGCCTGCTCTGGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414064    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031490.2-3088s21c1
Sequence:CCGGACCATTACCTTAGTGGATTTACTCGAGTAAATCCACTAAGGTAATGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031490.2-1494s21c1
Sequence:CCGGCATAACTTCACAGATCATTATCTCGAGATAATGATCTGTGAAGTTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031490.2-413s21c1
Sequence:CCGGCCAGATTGTACAGGTCTTAAACTCGAGTTTAAGACCTGTACAATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031490
VALIDATED
LONP2 MISSION shRNA Lentiviral Transduction Particles
lon peptidase 2, peroxisomal
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000046828    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031490.2-3174s1c1
Sequence:CCGGGCCAACTATTCTTGGCTATATCTCGAGATATAGCCAAGAATAGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_031490.2-990s1c1
Sequence:CCGGCCTCAGTCAATGCCAGAATATCTCGAGATATTCTGGCATTGACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_031490.2-2048s1c1
Sequence:CCGGGCCAGGAGTAGCAATAGGTTTCTCGAGAAACCTATTGCTACTCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_031490.2-735s1c1
Sequence:CCGGCCACTGCTTGTCAGACAAATTCTCGAGAATTTGTCTGACAAGCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_031490.2-376s1c1
Sequence:CCGGCCCACTACACTCTGTTGATTACTCGAGTAATCAACAGAGTGTAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031490.2-2527s21c1
Sequence:CCGGGCAACGTACGACAGGATTTAACTCGAGTTAAATCCTGTCGTACGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031490.2-933s21c1
Sequence:CCGGATGCCAGAGCAGGCCCATAAACTCGAGTTTATGGGCCTGCTCTGGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414064    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031490.2-3088s21c1
Sequence:CCGGACCATTACCTTAGTGGATTTACTCGAGTAAATCCACTAAGGTAATGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031490.2-1494s21c1
Sequence:CCGGCATAACTTCACAGATCATTATCTCGAGATAATGATCTGTGAAGTTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031490.2-413s21c1
Sequence:CCGGCCAGATTGTACAGGTCTTAAACTCGAGTTTAAGACCTGTACAATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025827
VALIDATED
LONP2 MISSION shRNA Bacterial Glycerol Stock
lon peptidase 2, peroxisomal
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000033184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025827.2-977s1c1
Sequence:CCGGCCTCAGTCAATGCCTGAATATCTCGAGATATTCAGGCATTGACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025827.2-2096s1c1
Sequence:CCGGGCAAGTAGAATGGACGGTGAACTCGAGTTCACCGTCCATTCTACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033188    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025827.2-701s1c1
Sequence:CCGGGATCGGTTCAAGATGACCATACTCGAGTATGGTCATCTTGAACCGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025827.2-1480s1c1
Sequence:CCGGCCATAACTTCACAGATCACTACTCGAGTAGTGATCTGTGAAGTTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025827.2-2453s1c1
Sequence:CCGGGCAGGACTGAAGCAGATCATACTCGAGTATGATCTGCTTCAGTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025827.2-701s21c1
Sequence:CCGGGATCGGTTCAAGATGACCATACTCGAGTATGGTCATCTTGAACCGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025827.2-2453s21c1
Sequence:CCGGGCAGGACTGAAGCAGATCATACTCGAGTATGATCTGCTTCAGTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025827.2-977s21c1
Sequence:CCGGCCTCAGTCAATGCCTGAATATCTCGAGATATTCAGGCATTGACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025827.2-1480s21c1
Sequence:CCGGCCATAACTTCACAGATCACTACTCGAGTAGTGATCTGTGAAGTTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025827
VALIDATED
LONP2 MISSION shRNA shRNA Plasmid DNA
lon peptidase 2, peroxisomal
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000033184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025827.2-977s1c1
Sequence:CCGGCCTCAGTCAATGCCTGAATATCTCGAGATATTCAGGCATTGACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025827.2-2096s1c1
Sequence:CCGGGCAAGTAGAATGGACGGTGAACTCGAGTTCACCGTCCATTCTACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033188    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025827.2-701s1c1
Sequence:CCGGGATCGGTTCAAGATGACCATACTCGAGTATGGTCATCTTGAACCGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025827.2-1480s1c1
Sequence:CCGGCCATAACTTCACAGATCACTACTCGAGTAGTGATCTGTGAAGTTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025827.2-2453s1c1
Sequence:CCGGGCAGGACTGAAGCAGATCATACTCGAGTATGATCTGCTTCAGTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025827.2-701s21c1
Sequence:CCGGGATCGGTTCAAGATGACCATACTCGAGTATGGTCATCTTGAACCGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025827.2-2453s21c1
Sequence:CCGGGCAGGACTGAAGCAGATCATACTCGAGTATGATCTGCTTCAGTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025827.2-977s21c1
Sequence:CCGGCCTCAGTCAATGCCTGAATATCTCGAGATATTCAGGCATTGACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025827.2-1480s21c1
Sequence:CCGGCCATAACTTCACAGATCACTACTCGAGTAGTGATCTGTGAAGTTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025827
VALIDATED
LONP2 MISSION shRNA Lentiviral Transduction Particles
lon peptidase 2, peroxisomal
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000033184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025827.2-977s1c1
Sequence:CCGGCCTCAGTCAATGCCTGAATATCTCGAGATATTCAGGCATTGACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025827.2-2096s1c1
Sequence:CCGGGCAAGTAGAATGGACGGTGAACTCGAGTTCACCGTCCATTCTACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033188    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025827.2-701s1c1
Sequence:CCGGGATCGGTTCAAGATGACCATACTCGAGTATGGTCATCTTGAACCGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025827.2-1480s1c1
Sequence:CCGGCCATAACTTCACAGATCACTACTCGAGTAGTGATCTGTGAAGTTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025827.2-2453s1c1
Sequence:CCGGGCAGGACTGAAGCAGATCATACTCGAGTATGATCTGCTTCAGTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025827.2-701s21c1
Sequence:CCGGGATCGGTTCAAGATGACCATACTCGAGTATGGTCATCTTGAACCGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025827.2-2453s21c1
Sequence:CCGGGCAGGACTGAAGCAGATCATACTCGAGTATGATCTGCTTCAGTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025827.2-977s21c1
Sequence:CCGGCCTCAGTCAATGCCTGAATATCTCGAGATATTCAGGCATTGACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025827.2-1480s21c1
Sequence:CCGGCCATAACTTCACAGATCACTACTCGAGTAGTGATCTGTGAAGTTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks