EMAIL THIS PAGE TO A FRIEND

LONRF1

LON peptidase N-terminal domain and ring finger 1

Synonyms: RNF191
UniProtKB ID: Q17RB8, B4DM29, B4DU84, Q8TEA0, Q9BSV1
Gene ID:
Mouse(244421) LON peptidase N-terminal domain and ring finger 1
Rat(306505) LON peptidase N-terminal domain and ring finger 1
chicken(422742) LON peptidase N-terminal domain and ring finger 1
cow(504489) LON peptidase N-terminal domain and ring finger 1
Horse(100063536) LON peptidase N-terminal domain and ring finger 1
domestic cat(101091440) LON peptidase N-terminal domain and ring finger 1
dog(482886) LON peptidase N-terminal domain and ring finger 1
sheep(101112628) LON peptidase N-terminal domain and ring finger 1
naked mole-rat(101700898) LON peptidase N-terminal domain and ring finger 1
domestic guinea pig(100732441) LON peptidase N-terminal domain and ring finger 1
136 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001081150 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081150 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081150 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_152271 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152271 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152271 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152271 Rosetta Predictions human pricing
XM_001066614 Rosetta Predictions rat pricing
XM_224907 Rosetta Predictions rat pricing
NM_001081150 Rosetta Predictions mouse pricing
XM_146279 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152271 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00211066 predicted 1033
2 SASI_Hs02_00365792 predicted 898
3 SASI_Hs01_00211067 predicted 2421
4 SASI_Hs02_00365793 predicted 858
5 SASI_Hs01_00211068 predicted 2409
6 SASI_Hs01_00211069 predicted 1000
7 SASI_Hs01_00211070 predicted 2336
8 SASI_Hs01_00211072 predicted 1085
9 SASI_Hs01_00211073 predicted 1487
10 SASI_Hs01_00211074 predicted 2326
11 SASI_Hs01_00211071 predicted 1158
12 SASI_Hs01_00211075 predicted 1223
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001066614 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00318151 predicted 2167
2 SASI_Rn02_00318152 predicted 2274
3 SASI_Rn02_00318153 predicted 1753
4 SASI_Rn02_00318154 predicted 2437
5 SASI_Rn02_00318155 predicted 2010
6 SASI_Rn02_00318156 predicted 1808
7 SASI_Rn02_00318157 predicted 1649
8 SASI_Rn02_00318158 predicted 1403
9 SASI_Rn02_00318159 predicted 1683
10 SASI_Rn02_00318160 predicted 2140
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_224907 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00382368 predicted 2094
2 SASI_Rn02_00382369 predicted 1717
3 SASI_Rn02_00382370 predicted 2350
4 SASI_Rn02_00382371 predicted 2398
5 SASI_Rn02_00382372 predicted 1978
6 SASI_Rn02_00382373 predicted 1642
7 SASI_Rn02_00382374 predicted 1828
8 SASI_Rn02_00382375 predicted 1927
9 SASI_Rn02_00382376 predicted 1885
10 SASI_Rn02_00382377 predicted 2392
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081150 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00295671 predicted 1253
2 SASI_Mm02_00295672 predicted 1132
3 SASI_Mm02_00295673 predicted 1239
4 SASI_Mm02_00295674 predicted 2444
5 SASI_Mm02_00295675 predicted 2505
6 SASI_Mm02_00295676 predicted 1098
7 SASI_Mm02_00295677 predicted 2451
8 SASI_Mm02_00295678 predicted 1536
9 SASI_Mm02_00295679 predicted 2027
10 SASI_Mm02_00295680 predicted 1445
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_146279 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00203126 predicted 1249
2 SASI_Mm01_00203127 predicted 1136
3 SASI_Mm01_00203128 predicted 1239
4 SASI_Mm01_00203129 predicted 2450
5 SASI_Mm01_00203130 predicted 2516
6 SASI_Mm01_00203131 predicted 1110
7 SASI_Mm01_00203132 predicted 2455
8 SASI_Mm01_00203133 predicted 1540
9 SASI_Mm01_00203134 predicted 2030
10 SASI_Mm01_00203135 predicted 1443
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081150
VALIDATED
LONRF1 MISSION shRNA Bacterial Glycerol Stock
LON peptidase N-terminal domain and ring finger 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000251369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081150.1-2086s21c1
Sequence:CCGGTTATGGTTGTATGCTACAAATCTCGAGATTTGTAGCATACAACCATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081150.1-1922s21c1
Sequence:CCGGACCAAGAATGTCCCAATATTCCTCGAGGAATATTGGGACATTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081150.1-1435s21c1
Sequence:CCGGTGCCAGGGAGGACGGTTTAAACTCGAGTTTAAACCGTCCTCCCTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251371    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081150.1-3271s21c1
Sequence:CCGGCTACGGTCTAGAGTATCATTTCTCGAGAAATGATACTCTAGACCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081150.1-2490s21c1
Sequence:CCGGAGGAACGGTTGACGAAGATACCTCGAGGTATCTTCGTCAACCGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081150
VALIDATED
LONRF1 MISSION shRNA shRNA Plasmid DNA
LON peptidase N-terminal domain and ring finger 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000251369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081150.1-2086s21c1
Sequence:CCGGTTATGGTTGTATGCTACAAATCTCGAGATTTGTAGCATACAACCATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081150.1-1922s21c1
Sequence:CCGGACCAAGAATGTCCCAATATTCCTCGAGGAATATTGGGACATTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081150.1-1435s21c1
Sequence:CCGGTGCCAGGGAGGACGGTTTAAACTCGAGTTTAAACCGTCCTCCCTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251371    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081150.1-3271s21c1
Sequence:CCGGCTACGGTCTAGAGTATCATTTCTCGAGAAATGATACTCTAGACCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081150.1-2490s21c1
Sequence:CCGGAGGAACGGTTGACGAAGATACCTCGAGGTATCTTCGTCAACCGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081150
VALIDATED
LONRF1 MISSION shRNA Lentiviral Transduction Particles
LON peptidase N-terminal domain and ring finger 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000251369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081150.1-2086s21c1
Sequence:CCGGTTATGGTTGTATGCTACAAATCTCGAGATTTGTAGCATACAACCATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081150.1-1922s21c1
Sequence:CCGGACCAAGAATGTCCCAATATTCCTCGAGGAATATTGGGACATTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081150.1-1435s21c1
Sequence:CCGGTGCCAGGGAGGACGGTTTAAACTCGAGTTTAAACCGTCCTCCCTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251371    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081150.1-3271s21c1
Sequence:CCGGCTACGGTCTAGAGTATCATTTCTCGAGAAATGATACTCTAGACCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081150.1-2490s21c1
Sequence:CCGGAGGAACGGTTGACGAAGATACCTCGAGGTATCTTCGTCAACCGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152271
VALIDATED
LONRF1 MISSION shRNA Bacterial Glycerol Stock
LON peptidase N-terminal domain and ring finger 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000230352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_152271.3-1445s21c1
Sequence:CCGGCCTTAGCTTATGGTGATATTCCTCGAGGAATATCACCATAAGCTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230354    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_152271.3-2333s21c1
Sequence:CCGGTGACCAAGATACAGCATATACCTCGAGGTATATGCTGTATCTTGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152271.3-1580s21c1
Sequence:GTACCGGGTTTAGATCATGCACCATATTCTCGAGAATATGGTGCATGATCTAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230355    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_152271.3-3267s21c1
Sequence:CCGGGCATAGTATAAACCCATTAAGCTCGAGCTTAATGGGTTTATACTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_152271.3-2033s21c1
Sequence:CCGGGATATTGCACTGCCGACATTGCTCGAGCAATGTCGGCAGTGCAATATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152271.2-381s1c1
Sequence:CCGGCCCAATGAAGTCTGTATGTTTCTCGAGAAACATACAGACTTCATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034063    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_152271.2-126s1c1
Sequence:CCGGCCAAAGCAGAGTGAAGAAATACTCGAGTATTTCTTCACTCTGCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_152271.2-1020s1c1
Sequence:CCGGGAAGATGTTAAGGTTGAGAATCTCGAGATTCTCAACCTTAACATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034060    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_152271.2-773s1c1
Sequence:CCGGCCATGTATTTGAGCCAAGATACTCGAGTATCTTGGCTCAAATACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152271
VALIDATED
LONRF1 MISSION shRNA shRNA Plasmid DNA
LON peptidase N-terminal domain and ring finger 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000230352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_152271.3-1445s21c1
Sequence:CCGGCCTTAGCTTATGGTGATATTCCTCGAGGAATATCACCATAAGCTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230354    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_152271.3-2333s21c1
Sequence:CCGGTGACCAAGATACAGCATATACCTCGAGGTATATGCTGTATCTTGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152271.3-1580s21c1
Sequence:GTACCGGGTTTAGATCATGCACCATATTCTCGAGAATATGGTGCATGATCTAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230355    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_152271.3-3267s21c1
Sequence:CCGGGCATAGTATAAACCCATTAAGCTCGAGCTTAATGGGTTTATACTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_152271.3-2033s21c1
Sequence:CCGGGATATTGCACTGCCGACATTGCTCGAGCAATGTCGGCAGTGCAATATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152271.2-381s1c1
Sequence:CCGGCCCAATGAAGTCTGTATGTTTCTCGAGAAACATACAGACTTCATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034063    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_152271.2-126s1c1
Sequence:CCGGCCAAAGCAGAGTGAAGAAATACTCGAGTATTTCTTCACTCTGCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_152271.2-1020s1c1
Sequence:CCGGGAAGATGTTAAGGTTGAGAATCTCGAGATTCTCAACCTTAACATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034060    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_152271.2-773s1c1
Sequence:CCGGCCATGTATTTGAGCCAAGATACTCGAGTATCTTGGCTCAAATACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152271
VALIDATED
LONRF1 MISSION shRNA Lentiviral Transduction Particles
LON peptidase N-terminal domain and ring finger 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000230352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_152271.3-1445s21c1
Sequence:CCGGCCTTAGCTTATGGTGATATTCCTCGAGGAATATCACCATAAGCTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230354    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_152271.3-2333s21c1
Sequence:CCGGTGACCAAGATACAGCATATACCTCGAGGTATATGCTGTATCTTGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152271.3-1580s21c1
Sequence:GTACCGGGTTTAGATCATGCACCATATTCTCGAGAATATGGTGCATGATCTAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230355    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_152271.3-3267s21c1
Sequence:CCGGGCATAGTATAAACCCATTAAGCTCGAGCTTAATGGGTTTATACTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_152271.3-2033s21c1
Sequence:CCGGGATATTGCACTGCCGACATTGCTCGAGCAATGTCGGCAGTGCAATATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152271.2-381s1c1
Sequence:CCGGCCCAATGAAGTCTGTATGTTTCTCGAGAAACATACAGACTTCATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034063    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_152271.2-126s1c1
Sequence:CCGGCCAAAGCAGAGTGAAGAAATACTCGAGTATTTCTTCACTCTGCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_152271.2-1020s1c1
Sequence:CCGGGAAGATGTTAAGGTTGAGAATCTCGAGATTCTCAACCTTAACATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034060    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_152271.2-773s1c1
Sequence:CCGGCCATGTATTTGAGCCAAGATACTCGAGTATCTTGGCTCAAATACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks