EMAIL THIS PAGE TO A FRIEND

LOX

lysyl oxidase

UniProtKB ID: P28300, B2R5Q3, Q5FWF0
Gene ID:
Human(4015) Summary: The protein encoded by this gene is an extracellular copper enzyme that initiates the crosslinking of collagens and elastin. The enzyme catalyzes oxidative deamination of the epsilon-amino group in certain lysine and hydroxylysine residues of collagens and lysine residues of elastin. In addition to crosslinking extracellular matrix proteins, the encoded protein may have a role in tumor suppression. Defects in this gene are a cause of autosomal recessive cutis laxa type I (CL type I). Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2010]
Mouse(16948) lysyl oxidase
Rat(24914) lysyl oxidase
Zebrafish(404621) lysyl oxidase
chicken(396474) lysyl oxidase
cow(280841) lysyl oxidase
domestic cat(101092985) lysyl oxidase
dog(481478) lysyl oxidase
fruit fly(43712) lysyl oxidase-like
sheep(101112220) lysyl oxidase
98 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010728 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010728 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010728 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002317 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002317 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002317 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002317 Rosetta Predictions human pricing
NM_017061 Rosetta Predictions rat pricing
XM_579391 Rosetta Predictions rat pricing
NM_010728 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002317 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00093318 predicted 1583
2 SASI_Hs01_00093319 predicted 1514
3 SASI_Hs01_00093322 predicted 955
4 SASI_Hs01_00093323 predicted 1276
5 SASI_Hs02_00333640 predicted 1430
6 SASI_Hs01_00093324 predicted 821
7 SASI_Hs02_00333641 predicted 1302
8 SASI_Hs01_00093326 predicted 1386
9 SASI_Hs01_00093327 predicted 1120
10 SASI_Hs02_00333642 predicted 1014
11 SASI_Hs01_00093320 predicted 1345
12 SASI_Hs01_00093321 predicted 1306
13 SASI_Hs01_00093325 predicted 1442
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017061 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00047788 predicted 893
2 SASI_Rn02_00261258 predicted 1267
3 SASI_Rn02_00261259 predicted 998
4 SASI_Rn02_00261260 predicted 1407
5 SASI_Rn02_00261261 predicted 913
6 SASI_Rn01_00047794 predicted 1396
7 SASI_Rn01_00047795 predicted 427
8 SASI_Rn02_00261262 predicted 1533
9 SASI_Rn02_00261263 predicted 1441
10 SASI_Rn02_00261264 predicted 1498
11 SASI_Rn01_00047789 predicted 1734
12 SASI_Rn01_00047790 predicted 1699
13 SASI_Rn01_00047791 predicted 1783
14 SASI_Rn01_00047792 predicted 1755
15 SASI_Rn01_00047793 predicted 1800
16 SASI_Rn01_00047796 predicted 1752
17 SASI_Rn01_00047797 predicted 1597
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579391 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00154645 predicted 868
2 SASI_Rn01_00154646 predicted 1239
3 SASI_Rn01_00154647 predicted 935
4 SASI_Rn01_00154648 predicted 882
5 SASI_Rn01_00154649 predicted 1317
6 SASI_Rn01_00154650 predicted 678
7 SASI_Rn01_00154651 predicted 532
8 SASI_Rn01_00154652 predicted 1310
9 SASI_Rn01_00154653 predicted 1030
10 SASI_Rn01_00154654 predicted 1050
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010728 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00319224 predicted 1388
2 SASI_Mm01_00173453 predicted 1411
3 SASI_Mm01_00173454 predicted 1472
4 SASI_Mm01_00173455 predicted 1428
5 SASI_Mm01_00173456 predicted 1474
6 SASI_Mm02_00319225 predicted 1146
7 SASI_Mm01_00173458 predicted 1648
8 SASI_Mm01_00173459 predicted 1664
9 SASI_Mm01_00173460 predicted 625
10 SASI_Mm01_00173461 predicted 1522
11 SASI_Mm01_00173457 predicted 1037
12 SASI_Mm01_00173462 predicted 1440
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010728
VALIDATED
LOX MISSION shRNA Bacterial Glycerol Stock
lysyl oxidase
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000321076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010728.2-1593s21c1
Sequence:CCGGGCTGCACAATTTCACCGTATTCTCGAGAATACGGTGAAATTGTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321077    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010728.2-2002s21c1
Sequence:CCGGCAATGATGATGAGCCTATATTCTCGAGAATATAGGCTCATCATCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010728.2-1519s21c1
Sequence:CCGGGCCTGAATCAGACTACACTAACTCGAGTTAGTGTAGTCTGATTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010728.2-1042s21c1
Sequence:CCGGCGTCCAGAAGATGTCTATGTACTCGAGTACATAGACATCTTCTGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011852    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010728.1-1514s1c1
Sequence:CCGGGCCTGAATCAGACTACACTAACTCGAGTTAGTGTAGTCTGATTCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010728.1-1037s1c1
Sequence:CCGGCGTCCAGAAGATGTCTATGTACTCGAGTACATAGACATCTTCTGGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011848    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010728.1-4490s1c1
Sequence:CCGGCCACTTTATGTATGCTTCATTCTCGAGAATGAAGCATACATAAAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010728.1-1588s1c1
Sequence:CCGGGCTGCACAATTTCACCGTATTCTCGAGAATACGGTGAAATTGTGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010728.1-1401s1c1
Sequence:CCGGCCTGGATGTTATGACACCTATCTCGAGATAGGTGTCATAACATCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010728
VALIDATED
LOX MISSION shRNA shRNA Plasmid DNA
lysyl oxidase
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000321076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010728.2-1593s21c1
Sequence:CCGGGCTGCACAATTTCACCGTATTCTCGAGAATACGGTGAAATTGTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321077    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010728.2-2002s21c1
Sequence:CCGGCAATGATGATGAGCCTATATTCTCGAGAATATAGGCTCATCATCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010728.2-1519s21c1
Sequence:CCGGGCCTGAATCAGACTACACTAACTCGAGTTAGTGTAGTCTGATTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010728.2-1042s21c1
Sequence:CCGGCGTCCAGAAGATGTCTATGTACTCGAGTACATAGACATCTTCTGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011852    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010728.1-1514s1c1
Sequence:CCGGGCCTGAATCAGACTACACTAACTCGAGTTAGTGTAGTCTGATTCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010728.1-1037s1c1
Sequence:CCGGCGTCCAGAAGATGTCTATGTACTCGAGTACATAGACATCTTCTGGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011848    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010728.1-4490s1c1
Sequence:CCGGCCACTTTATGTATGCTTCATTCTCGAGAATGAAGCATACATAAAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010728.1-1588s1c1
Sequence:CCGGGCTGCACAATTTCACCGTATTCTCGAGAATACGGTGAAATTGTGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010728.1-1401s1c1
Sequence:CCGGCCTGGATGTTATGACACCTATCTCGAGATAGGTGTCATAACATCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010728
VALIDATED
LOX MISSION shRNA Lentiviral Transduction Particles
lysyl oxidase
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000321076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010728.2-1593s21c1
Sequence:CCGGGCTGCACAATTTCACCGTATTCTCGAGAATACGGTGAAATTGTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321077    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010728.2-2002s21c1
Sequence:CCGGCAATGATGATGAGCCTATATTCTCGAGAATATAGGCTCATCATCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010728.2-1519s21c1
Sequence:CCGGGCCTGAATCAGACTACACTAACTCGAGTTAGTGTAGTCTGATTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010728.2-1042s21c1
Sequence:CCGGCGTCCAGAAGATGTCTATGTACTCGAGTACATAGACATCTTCTGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011852    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010728.1-1514s1c1
Sequence:CCGGGCCTGAATCAGACTACACTAACTCGAGTTAGTGTAGTCTGATTCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010728.1-1037s1c1
Sequence:CCGGCGTCCAGAAGATGTCTATGTACTCGAGTACATAGACATCTTCTGGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011848    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010728.1-4490s1c1
Sequence:CCGGCCACTTTATGTATGCTTCATTCTCGAGAATGAAGCATACATAAAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010728.1-1588s1c1
Sequence:CCGGGCTGCACAATTTCACCGTATTCTCGAGAATACGGTGAAATTGTGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010728.1-1401s1c1
Sequence:CCGGCCTGGATGTTATGACACCTATCTCGAGATAGGTGTCATAACATCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002317
VALIDATED
LOX MISSION shRNA Bacterial Glycerol Stock
lysyl oxidase
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000293898    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002317.4-1452s21c1
Sequence:CCGGAGACTGCCAGTGGATTGATATCTCGAGATATCAATCCACTGGCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002317.4-912s21c1
Sequence:CCGGCGACAACCCTTATTACAACTACTCGAGTAGTTGTAATAAGGGTTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002317.4-1608s21c1
Sequence:CCGGCTGCACAATTTCACCGTATTACTCGAGTAATACGGTGAAATTGTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002317.4-1188s21c1
Sequence:CCGGCCAAGGGACATCAGATTTCTTCTCGAGAAGAAATCTGATGTCCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293943    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002317.4-1692s21c1
Sequence:CCGGGACTAACTTCAGTAGGATTTACTCGAGTAAATCCTACTGAAGTTAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045988    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002317.3-1318s1c1
Sequence:CCGGCCTGGCTGTTATGATACCTATCTCGAGATAGGTATCATAACAGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002317.3-1086s1c1
Sequence:CCGGCCAAGGGACATCAGATTTCTTCTCGAGAAGAAATCTGATGTCCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002317.3-1506s1c1
Sequence:CCGGCTGCACAATTTCACCGTATTACTCGAGTAATACGGTGAAATTGTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002317.3-810s1c1
Sequence:CCGGCGACAACCCTTATTACAACTACTCGAGTAGTTGTAATAAGGGTTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002317.3-1145s1c1
Sequence:CCGGGTCATCAACATTACCACAGTACTCGAGTACTGTGGTAATGTTGATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002317
VALIDATED
LOX MISSION shRNA shRNA Plasmid DNA
lysyl oxidase
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000293898    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002317.4-1452s21c1
Sequence:CCGGAGACTGCCAGTGGATTGATATCTCGAGATATCAATCCACTGGCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002317.4-912s21c1
Sequence:CCGGCGACAACCCTTATTACAACTACTCGAGTAGTTGTAATAAGGGTTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002317.4-1608s21c1
Sequence:CCGGCTGCACAATTTCACCGTATTACTCGAGTAATACGGTGAAATTGTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002317.4-1188s21c1
Sequence:CCGGCCAAGGGACATCAGATTTCTTCTCGAGAAGAAATCTGATGTCCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293943    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002317.4-1692s21c1
Sequence:CCGGGACTAACTTCAGTAGGATTTACTCGAGTAAATCCTACTGAAGTTAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045988    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002317.3-1318s1c1
Sequence:CCGGCCTGGCTGTTATGATACCTATCTCGAGATAGGTATCATAACAGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002317.3-1086s1c1
Sequence:CCGGCCAAGGGACATCAGATTTCTTCTCGAGAAGAAATCTGATGTCCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002317.3-1506s1c1
Sequence:CCGGCTGCACAATTTCACCGTATTACTCGAGTAATACGGTGAAATTGTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002317.3-810s1c1
Sequence:CCGGCGACAACCCTTATTACAACTACTCGAGTAGTTGTAATAAGGGTTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002317.3-1145s1c1
Sequence:CCGGGTCATCAACATTACCACAGTACTCGAGTACTGTGGTAATGTTGATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002317
VALIDATED
LOX MISSION shRNA Lentiviral Transduction Particles
lysyl oxidase
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000293898    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002317.4-1452s21c1
Sequence:CCGGAGACTGCCAGTGGATTGATATCTCGAGATATCAATCCACTGGCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002317.4-912s21c1
Sequence:CCGGCGACAACCCTTATTACAACTACTCGAGTAGTTGTAATAAGGGTTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002317.4-1608s21c1
Sequence:CCGGCTGCACAATTTCACCGTATTACTCGAGTAATACGGTGAAATTGTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002317.4-1188s21c1
Sequence:CCGGCCAAGGGACATCAGATTTCTTCTCGAGAAGAAATCTGATGTCCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293943    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002317.4-1692s21c1
Sequence:CCGGGACTAACTTCAGTAGGATTTACTCGAGTAAATCCTACTGAAGTTAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045988    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002317.3-1318s1c1
Sequence:CCGGCCTGGCTGTTATGATACCTATCTCGAGATAGGTATCATAACAGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002317.3-1086s1c1
Sequence:CCGGCCAAGGGACATCAGATTTCTTCTCGAGAAGAAATCTGATGTCCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002317.3-1506s1c1
Sequence:CCGGCTGCACAATTTCACCGTATTACTCGAGTAATACGGTGAAATTGTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002317.3-810s1c1
Sequence:CCGGCGACAACCCTTATTACAACTACTCGAGTAGTTGTAATAAGGGTTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002317.3-1145s1c1
Sequence:CCGGGTCATCAACATTACCACAGTACTCGAGTACTGTGGTAATGTTGATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks