EMAIL THIS PAGE TO A FRIEND

LOXL2

lysyl oxidase-like 2

Synonyms: LOR2 WS9-14
UniProtKB ID: Q9Y4K0, B2R5Q0, Q53HV3, Q9BW70, Q9Y5Y8
Gene ID:
Human(4017) Summary: This gene encodes a member of the lysyl oxidase gene family. The prototypic member of the family is essential to the biogenesis of connective tissue, encoding an extracellular copper-dependent amine oxidase that catalyses the first step in the formation of crosslinks in collagens and elastin. A highly conserved amino acid sequence at the C-terminus end appears to be sufficient for amine oxidase activity, suggesting that each family member may retain this function. The N-terminus is poorly conserved and may impart additional roles in developmental regulation, senescence, tumor suppression, cell growth control, and chemotaxis to each member of the family. [provided by RefSeq, Jul 2008]
Mouse(94352) lysyl oxidase-like 2
Rat(290350) lysyl oxidase-like 2
chicken(419533) lysyl oxidase-like 2
cow(532684) lysyl oxidase-like 2
domestic cat(101084102) lysyl oxidase-like 2
dog(486118) lysyl oxidase-like 2
naked mole-rat(101700042) lysyl oxidase-like 2
Domestic Rabbit(100346678) lysyl oxidase-like 2
domestic guinea pig(100729973) lysyl oxidase-like 2
sheep(101120812) lysyl oxidase-like 2
62 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002318 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002318 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002318 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_033325 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_033325 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_033325 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002318 Rosetta Predictions human pricing
NM_001106047 Rosetta Predictions rat pricing
NM_033325 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002318 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00097658 predicted 2576
2 SASI_Hs01_00097659 predicted 2482
3 SASI_Hs01_00097660 predicted 1520
4 SASI_Hs01_00097661 predicted 1060
5 SASI_Hs01_00097662 predicted 2498
6 SASI_Hs01_00097663 predicted 2448
7 SASI_Hs02_00333643 predicted 1814
8 SASI_Hs01_00097664 predicted 1275
9 SASI_Hs02_00333644 predicted 2556
10 SASI_Hs01_00097666 predicted 1842
11 SASI_Hs01_00097665 predicted 704
12 SASI_Hs01_00097667 predicted 1849
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106047 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00215102 predicted 1640
2 SASI_Rn02_00215103 predicted 2251
3 SASI_Rn02_00215104 predicted 565
4 SASI_Rn02_00215105 predicted 2244
5 SASI_Rn02_00215106 predicted 2286
6 SASI_Rn02_00215107 predicted 644
7 SASI_Rn02_00215108 predicted 1061
8 SASI_Rn02_00215109 predicted 2293
9 SASI_Rn02_00215110 predicted 2323
10 SASI_Rn02_00215111 predicted 2196
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033325 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00096905 predicted 669
2 SASI_Mm01_00096906 predicted 1272
3 SASI_Mm01_00096907 predicted 620
4 SASI_Mm02_00337339 predicted 951
5 SASI_Mm01_00096908 predicted 664
6 SASI_Mm01_00096909 predicted 1326
7 SASI_Mm01_00096910 predicted 1366
8 SASI_Mm01_00096912 predicted 2285
9 SASI_Mm01_00096913 predicted 649
10 SASI_Mm01_00096914 predicted 2336
11 SASI_Mm01_00096911 predicted 2298
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002318
LOXL2 MISSION shRNA Bacterial Glycerol Stock
lysyl oxidase-like 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000046193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002318.1-769s1c1
Sequence:CCGGCCAGATAGAGAACCTGAATATCTCGAGATATTCAGGTTCTCTATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002318.1-2237s1c1
Sequence:CCGGGAAGGAGACATCCAGAAGAATCTCGAGATTCTTCTGGATGTCTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002318.1-962s1c1
Sequence:CCGGGAGAGGACATACAATACCAAACTCGAGTTTGGTATTGTATGTCCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002318.1-2416s1c1
Sequence:CCGGCGATTACTCCAACAACATCATCTCGAGATGATGTTGTTGGAGTAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002318.1-737s1c1
Sequence:CCGGCCTGGGTTCAAATTTGACAATCTCGAGATTGTCAAATTTGAACCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359075    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002318.2-3148s21c1
Sequence:CCGGGAAACCCTCCAGTCTATTATACTCGAGTATAATAGACTGGAGGGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002318.2-2460s21c1
Sequence:CCGGCTACCTGTTCCAGGTTGTTATCTCGAGATAACAACCTGGAACAGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358994    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002318.2-1528s21c1
Sequence:CCGGGGCAATGAGAAGTCCATTATACTCGAGTATAATGGACTTCTCATTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002318
LOXL2 MISSION shRNA shRNA Plasmid DNA
lysyl oxidase-like 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000046193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002318.1-769s1c1
Sequence:CCGGCCAGATAGAGAACCTGAATATCTCGAGATATTCAGGTTCTCTATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002318.1-2237s1c1
Sequence:CCGGGAAGGAGACATCCAGAAGAATCTCGAGATTCTTCTGGATGTCTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002318.1-962s1c1
Sequence:CCGGGAGAGGACATACAATACCAAACTCGAGTTTGGTATTGTATGTCCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002318.1-2416s1c1
Sequence:CCGGCGATTACTCCAACAACATCATCTCGAGATGATGTTGTTGGAGTAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002318.1-737s1c1
Sequence:CCGGCCTGGGTTCAAATTTGACAATCTCGAGATTGTCAAATTTGAACCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359075    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002318.2-3148s21c1
Sequence:CCGGGAAACCCTCCAGTCTATTATACTCGAGTATAATAGACTGGAGGGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002318.2-2460s21c1
Sequence:CCGGCTACCTGTTCCAGGTTGTTATCTCGAGATAACAACCTGGAACAGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358994    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002318.2-1528s21c1
Sequence:CCGGGGCAATGAGAAGTCCATTATACTCGAGTATAATGGACTTCTCATTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002318
LOXL2 MISSION shRNA Lentiviral Transduction Particles
lysyl oxidase-like 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000046193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002318.1-769s1c1
Sequence:CCGGCCAGATAGAGAACCTGAATATCTCGAGATATTCAGGTTCTCTATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002318.1-2237s1c1
Sequence:CCGGGAAGGAGACATCCAGAAGAATCTCGAGATTCTTCTGGATGTCTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002318.1-962s1c1
Sequence:CCGGGAGAGGACATACAATACCAAACTCGAGTTTGGTATTGTATGTCCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002318.1-2416s1c1
Sequence:CCGGCGATTACTCCAACAACATCATCTCGAGATGATGTTGTTGGAGTAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002318.1-737s1c1
Sequence:CCGGCCTGGGTTCAAATTTGACAATCTCGAGATTGTCAAATTTGAACCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359075    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002318.2-3148s21c1
Sequence:CCGGGAAACCCTCCAGTCTATTATACTCGAGTATAATAGACTGGAGGGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002318.2-2460s21c1
Sequence:CCGGCTACCTGTTCCAGGTTGTTATCTCGAGATAACAACCTGGAACAGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358994    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002318.2-1528s21c1
Sequence:CCGGGGCAATGAGAAGTCCATTATACTCGAGTATAATGGACTTCTCATTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033325
LOXL2 MISSION shRNA Bacterial Glycerol Stock
lysyl oxidase-like 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000076708    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033325.1-2739s1c1
Sequence:CCGGGCTGAGAAGAAAGGTGCTCATCTCGAGATGAGCACCTTTCTTCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033325.1-1628s1c1
Sequence:CCGGGCATGGAAATATCTTCGCCAACTCGAGTTGGCGAAGATATTTCCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033325.1-665s1c1
Sequence:CCGGCCAAATAGAGAGCCTAAATATCTCGAGATATTTAGGCTCTCTATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033325.1-662s1c1
Sequence:CCGGCAACCAAATAGAGAGCCTAAACTCGAGTTTAGGCTCTCTATTTGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033325.1-1787s1c1
Sequence:CCGGCCTGGTGCTTAATGCTGAGATCTCGAGATCTCAGCATTAAGCACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033325
LOXL2 MISSION shRNA shRNA Plasmid DNA
lysyl oxidase-like 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000076708    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033325.1-2739s1c1
Sequence:CCGGGCTGAGAAGAAAGGTGCTCATCTCGAGATGAGCACCTTTCTTCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033325.1-1628s1c1
Sequence:CCGGGCATGGAAATATCTTCGCCAACTCGAGTTGGCGAAGATATTTCCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033325.1-665s1c1
Sequence:CCGGCCAAATAGAGAGCCTAAATATCTCGAGATATTTAGGCTCTCTATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033325.1-662s1c1
Sequence:CCGGCAACCAAATAGAGAGCCTAAACTCGAGTTTAGGCTCTCTATTTGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033325.1-1787s1c1
Sequence:CCGGCCTGGTGCTTAATGCTGAGATCTCGAGATCTCAGCATTAAGCACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033325
LOXL2 MISSION shRNA Lentiviral Transduction Particles
lysyl oxidase-like 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000076708    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033325.1-2739s1c1
Sequence:CCGGGCTGAGAAGAAAGGTGCTCATCTCGAGATGAGCACCTTTCTTCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033325.1-1628s1c1
Sequence:CCGGGCATGGAAATATCTTCGCCAACTCGAGTTGGCGAAGATATTTCCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033325.1-665s1c1
Sequence:CCGGCCAAATAGAGAGCCTAAATATCTCGAGATATTTAGGCTCTCTATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033325.1-662s1c1
Sequence:CCGGCAACCAAATAGAGAGCCTAAACTCGAGTTTAGGCTCTCTATTTGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033325.1-1787s1c1
Sequence:CCGGCCTGGTGCTTAATGCTGAGATCTCGAGATCTCAGCATTAAGCACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks