EMAIL THIS PAGE TO A FRIEND

LPAL2

lipoprotein, Lp(a)-like 2, pseudogene

Synonyms: APOA2 APOAL APOARGC RP11-72O9.2
Species: Human LPAL2(80350)
UniProtKB ID: Q16609, E1P5B4
Gene ID:
65 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024492 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024492 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024492 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024492 Rosetta Predictions human pricing
NM_145727 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024492 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00082938 predicted 659
2 SASI_Hs01_00082940 predicted 896
3 SASI_Hs01_00082941 predicted 469
4 SASI_Hs01_00082942 predicted 312
5 SASI_Hs01_00082943 predicted 372
6 SASI_Hs01_00082944 predicted 705
7 SASI_Hs01_00082945 predicted 348
8 SASI_Hs02_00356758 predicted 752
9 SASI_Hs01_00082939 predicted 809
10 SASI_Hs02_00356759 predicted 553
11 SASI_Hs01_00082946 predicted 676
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145727 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00064291 predicted 658
2 SASI_Hs01_00064293 predicted 896
3 SASI_Hs01_00064294 predicted 469
4 SASI_Hs01_00064295 predicted 317
5 SASI_Hs01_00064296 predicted 374
6 SASI_Hs01_00064297 predicted 707
7 SASI_Hs01_00064298 predicted 353
8 SASI_Hs02_00365323 predicted 744
9 SASI_Hs01_00064292 predicted 816
10 SASI_Hs02_00365324 predicted 552
11 SASI_Hs01_00064299 predicted 682
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024492
LPAL2 MISSION shRNA Bacterial Glycerol Stock
lipoprotein, Lp(a)-like 2, pseudogene
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000118393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024492.2-487s1c1
Sequence:CCGGCTAGAGGATTCATTCATACAACTCGAGTTGTATGAATGAATCCTCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024492.2-464s1c1
Sequence:CCGGTGACTGTTATCCCAGTTCCAACTCGAGTTGGAACTGGGATAACAGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118392    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024492.2-1211s1c1
Sequence:CCGGCCCTGGTGTTACACAACTGATCTCGAGATCAGTTGTGTAACACCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024492.2-324s1c1
Sequence:CCGGTGATGGCTTGATCTCGAACTACTCGAGTAGTTCGAGATCAAGCCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024492.2-484s1c1
Sequence:CCGGAGCCTAGAGGATTCATTCATACTCGAGTATGAATGAATCCTCTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024492
LPAL2 MISSION shRNA shRNA Plasmid DNA
lipoprotein, Lp(a)-like 2, pseudogene
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000118393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024492.2-487s1c1
Sequence:CCGGCTAGAGGATTCATTCATACAACTCGAGTTGTATGAATGAATCCTCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024492.2-464s1c1
Sequence:CCGGTGACTGTTATCCCAGTTCCAACTCGAGTTGGAACTGGGATAACAGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118392    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024492.2-1211s1c1
Sequence:CCGGCCCTGGTGTTACACAACTGATCTCGAGATCAGTTGTGTAACACCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024492.2-324s1c1
Sequence:CCGGTGATGGCTTGATCTCGAACTACTCGAGTAGTTCGAGATCAAGCCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024492.2-484s1c1
Sequence:CCGGAGCCTAGAGGATTCATTCATACTCGAGTATGAATGAATCCTCTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024492
LPAL2 MISSION shRNA Lentiviral Transduction Particles
lipoprotein, Lp(a)-like 2, pseudogene
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000118393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024492.2-487s1c1
Sequence:CCGGCTAGAGGATTCATTCATACAACTCGAGTTGTATGAATGAATCCTCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024492.2-464s1c1
Sequence:CCGGTGACTGTTATCCCAGTTCCAACTCGAGTTGGAACTGGGATAACAGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118392    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024492.2-1211s1c1
Sequence:CCGGCCCTGGTGTTACACAACTGATCTCGAGATCAGTTGTGTAACACCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024492.2-324s1c1
Sequence:CCGGTGATGGCTTGATCTCGAACTACTCGAGTAGTTCGAGATCAAGCCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024492.2-484s1c1
Sequence:CCGGAGCCTAGAGGATTCATTCATACTCGAGTATGAATGAATCCTCTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks