EMAIL THIS PAGE TO A FRIEND

LPGAT1

lysophosphatidylglycerol acyltransferase 1

Synonyms: FAM34A FAM34A1 NET8
UniProtKB ID: Q92604
Gene ID:
Human(9926) Summary: Acyl-CoA:lysophosphatidylglycerol (LPG) acyltransferase catalyzes the reacylation of LPG to phosphatidylglycerol, a membrane phospholipid that is an important precursor for the synthesis of cardiolipin (Yang et al., 2004 [PubMed 15485873]
Mouse(226856) lysophosphatidylglycerol acyltransferase 1
Rat(679692) lysophosphatidylglycerol acyltransferase 1
Zebrafish(561832) lysophosphatidylglycerol acyltransferase 1
cow(541208) lysophosphatidylglycerol acyltransferase 1
Horse(100051072) lysophosphatidylglycerol acyltransferase 1
dog(609933) lysophosphatidylglycerol acyltransferase 1
domestic cat(101085521) lysophosphatidylglycerol acyltransferase 1
chicken(421375) lysophosphatidylglycerol acyltransferase 1
domestic guinea pig(100714870) lysophosphatidylglycerol acyltransferase 1
naked mole-rat(101707603) lysophosphatidylglycerol acyltransferase 1
sheep(101118717) lysophosphatidylglycerol acyltransferase 1
174 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172266 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172266 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172266 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014873 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014873 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014873 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014873 Rosetta Predictions human pricing
NM_001109376 Rosetta Predictions rat pricing
NM_172266 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014873 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00037579 predicted 1056
2 SASI_Hs01_00037581 predicted 1001
3 SASI_Hs01_00037582 predicted 892
4 SASI_Hs01_00037583 predicted 394
5 SASI_Hs01_00037584 predicted 983
6 SASI_Hs01_00037585 predicted 1127
7 SASI_Hs01_00037586 predicted 677
8 SASI_Hs01_00037587 predicted 884
9 SASI_Hs01_00037588 predicted 937
10 SASI_Hs02_00346478 predicted 803
11 SASI_Hs01_00037580 predicted 944
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109376 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00247806 predicted 1224
2 SASI_Rn02_00247807 predicted 511
3 SASI_Rn02_00247808 predicted 517
4 SASI_Rn02_00247809 predicted 1126
5 SASI_Rn02_00247810 predicted 854
6 SASI_Rn02_00247811 predicted 1266
7 SASI_Rn02_00247812 predicted 741
8 SASI_Rn02_00247813 predicted 501
9 SASI_Rn02_00247814 predicted 1205
10 SASI_Rn02_00247815 predicted 581
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172266 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00180945 predicted 1020
2 SASI_Mm01_00180946 predicted 962
3 SASI_Mm01_00180947 predicted 554
4 SASI_Mm01_00180948 predicted 341
5 SASI_Mm02_00343735 predicted 292
6 SASI_Mm01_00180950 predicted 845
7 SASI_Mm01_00180951 predicted 407
8 SASI_Mm02_00343736 predicted 887
9 SASI_Mm01_00180952 predicted 374
10 SASI_Mm01_00180953 predicted 295
11 SASI_Mm01_00180949 predicted 543
12 SASI_Mm01_00180954 predicted 879
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172266
VALIDATED
LPGAT1 MISSION shRNA Bacterial Glycerol Stock
lysophosphatidylglycerol acyltransferase 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000125613    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172266.1-388s1c1
Sequence:CCGGCGCTAAAGATGAAGCAGTGATCTCGAGATCACTGCTTCATCTTTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125609    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172266.1-1248s1c1
Sequence:CCGGGCTACATAGGAGTTCAGACTTCTCGAGAAGTCTGAACTCCTATGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172266.1-1132s1c1
Sequence:CCGGCCTCAGCAACATGTGGATATTCTCGAGAATATCCACATGTTGCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125612    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172266.1-834s1c1
Sequence:CCGGCTAGAGGCTTAGAATGCAAATCTCGAGATTTGCATTCTAAGCCTCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172266.1-218s1c1
Sequence:CCGGCCATCCTACATCTGCTATGTACTCGAGTACATAGCAGATGTAGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172266.3-309s21c1
Sequence:CCGGCCATCCTACATCTGCTATGTACTCGAGTACATAGCAGATGTAGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323855    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172266.3-1339s21c1
Sequence:CCGGGCTACATAGGAGTTCAGACTTCTCGAGAAGTCTGAACTCCTATGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172266.3-925s21c1
Sequence:CCGGCTAGAGGCTTAGAATGCAAATCTCGAGATTTGCATTCTAAGCCTCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172266.3-1223s21c1
Sequence:CCGGCCTCAGCAACATGTGGATATTCTCGAGAATATCCACATGTTGCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172266
VALIDATED
LPGAT1 MISSION shRNA shRNA Plasmid DNA
lysophosphatidylglycerol acyltransferase 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000125613    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172266.1-388s1c1
Sequence:CCGGCGCTAAAGATGAAGCAGTGATCTCGAGATCACTGCTTCATCTTTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125609    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172266.1-1248s1c1
Sequence:CCGGGCTACATAGGAGTTCAGACTTCTCGAGAAGTCTGAACTCCTATGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172266.1-1132s1c1
Sequence:CCGGCCTCAGCAACATGTGGATATTCTCGAGAATATCCACATGTTGCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125612    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172266.1-834s1c1
Sequence:CCGGCTAGAGGCTTAGAATGCAAATCTCGAGATTTGCATTCTAAGCCTCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172266.1-218s1c1
Sequence:CCGGCCATCCTACATCTGCTATGTACTCGAGTACATAGCAGATGTAGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172266.3-309s21c1
Sequence:CCGGCCATCCTACATCTGCTATGTACTCGAGTACATAGCAGATGTAGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323855    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172266.3-1339s21c1
Sequence:CCGGGCTACATAGGAGTTCAGACTTCTCGAGAAGTCTGAACTCCTATGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172266.3-925s21c1
Sequence:CCGGCTAGAGGCTTAGAATGCAAATCTCGAGATTTGCATTCTAAGCCTCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172266.3-1223s21c1
Sequence:CCGGCCTCAGCAACATGTGGATATTCTCGAGAATATCCACATGTTGCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172266
VALIDATED
LPGAT1 MISSION shRNA Lentiviral Transduction Particles
lysophosphatidylglycerol acyltransferase 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000125613    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172266.1-388s1c1
Sequence:CCGGCGCTAAAGATGAAGCAGTGATCTCGAGATCACTGCTTCATCTTTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125609    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172266.1-1248s1c1
Sequence:CCGGGCTACATAGGAGTTCAGACTTCTCGAGAAGTCTGAACTCCTATGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172266.1-1132s1c1
Sequence:CCGGCCTCAGCAACATGTGGATATTCTCGAGAATATCCACATGTTGCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125612    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172266.1-834s1c1
Sequence:CCGGCTAGAGGCTTAGAATGCAAATCTCGAGATTTGCATTCTAAGCCTCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172266.1-218s1c1
Sequence:CCGGCCATCCTACATCTGCTATGTACTCGAGTACATAGCAGATGTAGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172266.3-309s21c1
Sequence:CCGGCCATCCTACATCTGCTATGTACTCGAGTACATAGCAGATGTAGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323855    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172266.3-1339s21c1
Sequence:CCGGGCTACATAGGAGTTCAGACTTCTCGAGAAGTCTGAACTCCTATGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172266.3-925s21c1
Sequence:CCGGCTAGAGGCTTAGAATGCAAATCTCGAGATTTGCATTCTAAGCCTCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172266.3-1223s21c1
Sequence:CCGGCCTCAGCAACATGTGGATATTCTCGAGAATATCCACATGTTGCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014873
VALIDATED
LPGAT1 MISSION shRNA Bacterial Glycerol Stock
lysophosphatidylglycerol acyltransferase 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000116064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014873.1-510s1c1
Sequence:CCGGGCAGTGATGTTGGTGAATCATCTCGAGATGATTCACCAACATCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116062    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014873.1-3418s1c1
Sequence:CCGGCGGTGAATAAATGAAACCAATCTCGAGATTGGTTTCATTTATTCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116063    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014873.1-800s1c1
Sequence:CCGGGCGAGAAACAAGTCAGGCATTCTCGAGAATGCCTGACTTGTTTCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014873.1-942s1c1
Sequence:CCGGGCTAAAGAATTAGACAGCAAACTCGAGTTTGCTGTCTAATTCTTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116066    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014873.1-654s1c1
Sequence:CCGGGTTCATGGAGACTTCTTTATACTCGAGTATAAAGAAGTCTCCATGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014873.2-601s21c1
Sequence:CCGGTGTGGTTGATGGATCATATTTCTCGAGAAATATGATCCATCAACCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014873.2-800s21c1
Sequence:CCGGGCGAGAAACAAGTCAGGCATTCTCGAGAATGCCTGACTTGTTTCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014873.2-510s21c1
Sequence:CCGGGCAGTGATGTTGGTGAATCATCTCGAGATGATTCACCAACATCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289966    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014873.2-654s21c1
Sequence:CCGGGTTCATGGAGACTTCTTTATACTCGAGTATAAAGAAGTCTCCATGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296360    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014873.2-1708s21c1
Sequence:CCGGCTCTTAGCTGTAGTCTATATTCTCGAGAATATAGACTACAGCTAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014873
VALIDATED
LPGAT1 MISSION shRNA shRNA Plasmid DNA
lysophosphatidylglycerol acyltransferase 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000116064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014873.1-510s1c1
Sequence:CCGGGCAGTGATGTTGGTGAATCATCTCGAGATGATTCACCAACATCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116062    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014873.1-3418s1c1
Sequence:CCGGCGGTGAATAAATGAAACCAATCTCGAGATTGGTTTCATTTATTCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116063    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014873.1-800s1c1
Sequence:CCGGGCGAGAAACAAGTCAGGCATTCTCGAGAATGCCTGACTTGTTTCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014873.1-942s1c1
Sequence:CCGGGCTAAAGAATTAGACAGCAAACTCGAGTTTGCTGTCTAATTCTTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116066    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014873.1-654s1c1
Sequence:CCGGGTTCATGGAGACTTCTTTATACTCGAGTATAAAGAAGTCTCCATGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014873.2-601s21c1
Sequence:CCGGTGTGGTTGATGGATCATATTTCTCGAGAAATATGATCCATCAACCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014873.2-800s21c1
Sequence:CCGGGCGAGAAACAAGTCAGGCATTCTCGAGAATGCCTGACTTGTTTCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014873.2-510s21c1
Sequence:CCGGGCAGTGATGTTGGTGAATCATCTCGAGATGATTCACCAACATCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289966    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014873.2-654s21c1
Sequence:CCGGGTTCATGGAGACTTCTTTATACTCGAGTATAAAGAAGTCTCCATGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296360    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014873.2-1708s21c1
Sequence:CCGGCTCTTAGCTGTAGTCTATATTCTCGAGAATATAGACTACAGCTAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014873
VALIDATED
LPGAT1 MISSION shRNA Lentiviral Transduction Particles
lysophosphatidylglycerol acyltransferase 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000116064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014873.1-510s1c1
Sequence:CCGGGCAGTGATGTTGGTGAATCATCTCGAGATGATTCACCAACATCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116062    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014873.1-3418s1c1
Sequence:CCGGCGGTGAATAAATGAAACCAATCTCGAGATTGGTTTCATTTATTCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116063    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014873.1-800s1c1
Sequence:CCGGGCGAGAAACAAGTCAGGCATTCTCGAGAATGCCTGACTTGTTTCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014873.1-942s1c1
Sequence:CCGGGCTAAAGAATTAGACAGCAAACTCGAGTTTGCTGTCTAATTCTTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116066    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014873.1-654s1c1
Sequence:CCGGGTTCATGGAGACTTCTTTATACTCGAGTATAAAGAAGTCTCCATGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014873.2-601s21c1
Sequence:CCGGTGTGGTTGATGGATCATATTTCTCGAGAAATATGATCCATCAACCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014873.2-800s21c1
Sequence:CCGGGCGAGAAACAAGTCAGGCATTCTCGAGAATGCCTGACTTGTTTCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014873.2-510s21c1
Sequence:CCGGGCAGTGATGTTGGTGAATCATCTCGAGATGATTCACCAACATCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289966    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014873.2-654s21c1
Sequence:CCGGGTTCATGGAGACTTCTTTATACTCGAGTATAAAGAAGTCTCCATGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296360    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014873.2-1708s21c1
Sequence:CCGGCTCTTAGCTGTAGTCTATATTCTCGAGAATATAGACTACAGCTAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks