EMAIL THIS PAGE TO A FRIEND

LPP

LIM domain containing preferred translocation partner in lipoma

UniProtKB ID: Q93052, A1L4L6, D3DNV6, Q8NFX5
Gene ID:
Human(4026) Summary: This gene encodes a member of a subfamily of LIM domain proteins that are characterized by an N-terminal proline rich region and three C-terminal LIM domains. The encoded protein localizes to the cell periphery in focal adhesions and may be involved in cell-cell adhesion and cell motility. This protein also shuttles through the nucleus and may function as a transcriptional co-activator. This gene is located at the junction of certain disease related chromosomal translocations which result in the expression of chimeric proteins that may promote tumor growth. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Mar 2010]
Mouse(210126) LIM domain containing preferred translocation partner in lipoma
Rat(288010) LIM domain containing preferred translocation partner in lipoma
sheep(101110107) LIM domain containing preferred translocation partner in lipoma
Domestic Rabbit(100354370) LIM domain containing preferred translocation partner in lipoma
naked mole-rat(101712406) LIM domain containing preferred translocation partner in lipoma
domestic guinea pig(100731600) LIM domain containing preferred translocation partner in lipoma
Zebrafish(573024) LIM domain containing preferred translocation partner in lipoma
cow(524132) LIM domain containing preferred translocation partner in lipoma
Horse(100059679) LIM domain containing preferred translocation partner in lipoma
domestic cat(101096257) LIM domain containing preferred translocation partner in lipoma
dog(478670) LIM domain containing preferred translocation partner in lipoma
chicken(429148) LIM domain containing preferred translocation partner in lipoma
244 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005578 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005578 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005578 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178665 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178665 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178665 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005578 Rosetta Predictions human pricing
NM_001013864 Rosetta Predictions rat pricing
NM_178665 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005578 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00071694 predicted 1728
2 SASI_Hs01_00071695 predicted 1725
3 SASI_Hs01_00071696 predicted 767
4 SASI_Hs01_00071698 predicted 1303
5 SASI_Hs01_00071699 predicted 1290
6 SASI_Hs01_00071700 predicted 1125
7 SASI_Hs01_00071701 predicted 1927
8 SASI_Hs02_00339861 predicted 1206
9 SASI_Hs02_00339862 predicted 1847
10 SASI_Hs02_00339863 predicted 751
11 SASI_Hs01_00071693 predicted 605
12 SASI_Hs01_00071697 predicted 520
13 SASI_Hs01_00071702 predicted 409
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013864 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00047910 predicted 1967
2 SASI_Rn01_00047911 predicted 1242
3 SASI_Rn01_00047912 predicted 1221
4 SASI_Rn01_00047913 predicted 1699
5 SASI_Rn01_00047914 predicted 1252
6 SASI_Rn01_00047916 predicted 1826
7 SASI_Rn02_00201131 predicted 1882
8 SASI_Rn01_00047917 predicted 629
9 SASI_Rn01_00047918 predicted 200
10 SASI_Rn02_00201132 predicted 1722
11 SASI_Rn01_00047909 predicted 1742
12 SASI_Rn01_00047915 predicted 1054
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178665 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00092667 predicted 1980
2 SASI_Mm01_00092668 predicted 2278
3 SASI_Mm01_00092669 predicted 1572
4 SASI_Mm01_00092670 predicted 1294
5 SASI_Mm01_00092671 predicted 1356
6 SASI_Mm01_00092672 predicted 1343
7 SASI_Mm01_00092673 predicted 528
8 SASI_Mm01_00092674 predicted 1284
9 SASI_Mm01_00092675 predicted 2070
10 SASI_Mm01_00092676 predicted 503
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005578
VALIDATED
LPP MISSION shRNA Bacterial Glycerol Stock
LIM domain containing preferred translocation partner in lipoma
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000083283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005578.1-1129s1c1
Sequence:CCGGCGCTATTATGAAGGCTACTATCTCGAGATAGTAGCCTTCATAATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005578.1-1606s1c1
Sequence:CCGGCAGCCATTCTATGCTGTGGAACTCGAGTTCCACAGCATAGAATGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_005578.1-900s1c1
Sequence:CCGGGCCTACCTTTAATGTGCAGGTCTCGAGACCTGCACATTAAAGGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083284    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_005578.1-485s1c1
Sequence:CCGGCCCTTCCATCTATCTCTGGAACTCGAGTTCCAGAGATAGATGGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_005578.2-485s21c1
Sequence:CCGGCCCTTCCATCTATCTCTGGAACTCGAGTTCCAGAGATAGATGGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_005578.2-900s21c1
Sequence:CCGGGCCTACCTTTAATGTGCAGGTCTCGAGACCTGCACATTAAAGGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_005578.2-1117s21c1
Sequence:CCGGCCCAACCAGGGACGCTATTATCTCGAGATAATAGCGTCCCTGGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323036    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005578.2-2485s21c1
Sequence:CCGGGAAATCTCCATCCTATCATTTCTCGAGAAATGATAGGATGGAGATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005578
VALIDATED
LPP MISSION shRNA shRNA Plasmid DNA
LIM domain containing preferred translocation partner in lipoma
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000083283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005578.1-1129s1c1
Sequence:CCGGCGCTATTATGAAGGCTACTATCTCGAGATAGTAGCCTTCATAATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005578.1-1606s1c1
Sequence:CCGGCAGCCATTCTATGCTGTGGAACTCGAGTTCCACAGCATAGAATGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_005578.1-900s1c1
Sequence:CCGGGCCTACCTTTAATGTGCAGGTCTCGAGACCTGCACATTAAAGGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083284    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_005578.1-485s1c1
Sequence:CCGGCCCTTCCATCTATCTCTGGAACTCGAGTTCCAGAGATAGATGGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_005578.2-485s21c1
Sequence:CCGGCCCTTCCATCTATCTCTGGAACTCGAGTTCCAGAGATAGATGGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_005578.2-900s21c1
Sequence:CCGGGCCTACCTTTAATGTGCAGGTCTCGAGACCTGCACATTAAAGGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_005578.2-1117s21c1
Sequence:CCGGCCCAACCAGGGACGCTATTATCTCGAGATAATAGCGTCCCTGGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323036    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005578.2-2485s21c1
Sequence:CCGGGAAATCTCCATCCTATCATTTCTCGAGAAATGATAGGATGGAGATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005578
VALIDATED
LPP MISSION shRNA Lentiviral Transduction Particles
LIM domain containing preferred translocation partner in lipoma
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000083283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005578.1-1129s1c1
Sequence:CCGGCGCTATTATGAAGGCTACTATCTCGAGATAGTAGCCTTCATAATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005578.1-1606s1c1
Sequence:CCGGCAGCCATTCTATGCTGTGGAACTCGAGTTCCACAGCATAGAATGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_005578.1-900s1c1
Sequence:CCGGGCCTACCTTTAATGTGCAGGTCTCGAGACCTGCACATTAAAGGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083284    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_005578.1-485s1c1
Sequence:CCGGCCCTTCCATCTATCTCTGGAACTCGAGTTCCAGAGATAGATGGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_005578.2-485s21c1
Sequence:CCGGCCCTTCCATCTATCTCTGGAACTCGAGTTCCAGAGATAGATGGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_005578.2-900s21c1
Sequence:CCGGGCCTACCTTTAATGTGCAGGTCTCGAGACCTGCACATTAAAGGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_005578.2-1117s21c1
Sequence:CCGGCCCAACCAGGGACGCTATTATCTCGAGATAATAGCGTCCCTGGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323036    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005578.2-2485s21c1
Sequence:CCGGGAAATCTCCATCCTATCATTTCTCGAGAAATGATAGGATGGAGATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178665
LPP MISSION shRNA Bacterial Glycerol Stock
LIM domain containing preferred translocation partner in lipoma
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000113495    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178665.3-2847s1c1
Sequence:CCGGCCCACTTTAGTCTGCAACTATCTCGAGATAGTTGCAGACTAAAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178665.3-1475s1c1
Sequence:CCGGCCTATATCACAGACCCTGTTTCTCGAGAAACAGGGTCTGTGATATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178665.3-1593s1c1
Sequence:CCGGCGAACACTTGACCAAGAAGATCTCGAGATCTTCTTGGTCAAGTGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178665.3-1293s1c1
Sequence:CCGGAGGACGCTATTATGAACCTTACTCGAGTAAGGTTCATAATAGCGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178665.3-1297s1c1
Sequence:CCGGCGCTATTATGAACCTTACTATCTCGAGATAGTAAGGTTCATAATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326187    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178665.5-2986s21c1
Sequence:CCGGCCCACTTTAGTCTGCAACTATCTCGAGATAGTTGCAGACTAAAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178665.5-1432s21c1
Sequence:CCGGAGGACGCTATTATGAACCTTACTCGAGTAAGGTTCATAATAGCGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178665.5-1614s21c1
Sequence:CCGGCCTATATCACAGACCCTGTTTCTCGAGAAACAGGGTCTGTGATATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178665.5-1732s21c1
Sequence:CCGGCGAACACTTGACCAAGAAGATCTCGAGATCTTCTTGGTCAAGTGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178665
LPP MISSION shRNA shRNA Plasmid DNA
LIM domain containing preferred translocation partner in lipoma
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000113495    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178665.3-2847s1c1
Sequence:CCGGCCCACTTTAGTCTGCAACTATCTCGAGATAGTTGCAGACTAAAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178665.3-1475s1c1
Sequence:CCGGCCTATATCACAGACCCTGTTTCTCGAGAAACAGGGTCTGTGATATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178665.3-1593s1c1
Sequence:CCGGCGAACACTTGACCAAGAAGATCTCGAGATCTTCTTGGTCAAGTGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178665.3-1293s1c1
Sequence:CCGGAGGACGCTATTATGAACCTTACTCGAGTAAGGTTCATAATAGCGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178665.3-1297s1c1
Sequence:CCGGCGCTATTATGAACCTTACTATCTCGAGATAGTAAGGTTCATAATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326187    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178665.5-2986s21c1
Sequence:CCGGCCCACTTTAGTCTGCAACTATCTCGAGATAGTTGCAGACTAAAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178665.5-1432s21c1
Sequence:CCGGAGGACGCTATTATGAACCTTACTCGAGTAAGGTTCATAATAGCGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178665.5-1614s21c1
Sequence:CCGGCCTATATCACAGACCCTGTTTCTCGAGAAACAGGGTCTGTGATATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178665.5-1732s21c1
Sequence:CCGGCGAACACTTGACCAAGAAGATCTCGAGATCTTCTTGGTCAAGTGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178665
LPP MISSION shRNA Lentiviral Transduction Particles
LIM domain containing preferred translocation partner in lipoma
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000113495    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178665.3-2847s1c1
Sequence:CCGGCCCACTTTAGTCTGCAACTATCTCGAGATAGTTGCAGACTAAAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178665.3-1475s1c1
Sequence:CCGGCCTATATCACAGACCCTGTTTCTCGAGAAACAGGGTCTGTGATATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178665.3-1593s1c1
Sequence:CCGGCGAACACTTGACCAAGAAGATCTCGAGATCTTCTTGGTCAAGTGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178665.3-1293s1c1
Sequence:CCGGAGGACGCTATTATGAACCTTACTCGAGTAAGGTTCATAATAGCGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178665.3-1297s1c1
Sequence:CCGGCGCTATTATGAACCTTACTATCTCGAGATAGTAAGGTTCATAATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326187    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178665.5-2986s21c1
Sequence:CCGGCCCACTTTAGTCTGCAACTATCTCGAGATAGTTGCAGACTAAAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178665.5-1432s21c1
Sequence:CCGGAGGACGCTATTATGAACCTTACTCGAGTAAGGTTCATAATAGCGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178665.5-1614s21c1
Sequence:CCGGCCTATATCACAGACCCTGTTTCTCGAGAAACAGGGTCTGTGATATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178665.5-1732s21c1
Sequence:CCGGCGAACACTTGACCAAGAAGATCTCGAGATCTTCTTGGTCAAGTGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks