EMAIL THIS PAGE TO A FRIEND

LPPR1

Synonyms: PRG-3
UniProtKB ID: Q8TBJ4, Q5VX23, Q9NXE2
Gene ID:
Human(54886) Summary: This gene encodes a member of the plasticity-related gene (PRG) family. Members of the PRG family mediate lipid phosphate phosphatase activity in neurons and are known to be involved in neuronal plasticity. The protein encoded by this gene does not perform its function through enzymatic phospholipid degradation. This gene is strongly expressed in brain. It shows dynamic expression regulation during brain development and neuronal excitation. Alternatively spliced transcript variants encoding the same protein have been observed. [provided by RefSeq, Jul 2008]
Rat(298062) lipid phosphate phosphatase-related protein type 1
Zebrafish(415222) lipid phosphate phosphatase-related protein type 1
dog(481633) lipid phosphate phosphatase-related protein type 1
cow(515209) lipid phosphate phosphatase-related protein type 1
130 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017753 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017753 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017753 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU022621 MISSION® esiRNA esiRNA human PPAPR3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017753 Rosetta Predictions human pricing
NM_207299 Rosetta Predictions human pricing
NM_201271 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017753 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00101036 predicted 886
2 SASI_Hs01_00101037 predicted 597
3 SASI_Hs02_00350567 predicted 530
4 SASI_Hs01_00101038 predicted 870
5 SASI_Hs01_00101039 predicted 416
6 SASI_Hs01_00101040 predicted 720
7 SASI_Hs01_00101041 predicted 743
8 SASI_Hs01_00101042 predicted 1072
9 SASI_Hs01_00101043 predicted 880
10 SASI_Hs01_00101044 predicted 842
11 SASI_Hs01_00101045 predicted 700
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207299 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00042612 predicted 1013
2 SASI_Hs01_00042613 predicted 726
3 SASI_Hs02_00373826 predicted 658
4 SASI_Hs01_00042614 predicted 1006
5 SASI_Hs01_00042615 predicted 554
6 SASI_Hs01_00042616 predicted 851
7 SASI_Hs01_00042617 predicted 878
8 SASI_Hs01_00042618 predicted 1210
9 SASI_Hs01_00042619 predicted 1022
10 SASI_Hs02_00373827 predicted 975
11 SASI_Hs01_00042620 predicted 840
12 SASI_Hs01_00042621 predicted 1003
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201271 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00061623 predicted 486
2 SASI_Rn01_00061624 predicted 540
3 SASI_Rn01_00061625 predicted 653
4 SASI_Rn01_00061626 predicted 660
5 SASI_Rn01_00061627 predicted 498
6 SASI_Rn01_00061628 predicted 542
7 SASI_Rn01_00061629 predicted 510
8 SASI_Rn01_00061630 predicted 529
9 SASI_Rn01_00061631 predicted 218
10 SASI_Rn01_00061632 predicted 208
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017753
LPPR1 MISSION shRNA Bacterial Glycerol Stock
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000359523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017753.2-622s21c1
Sequence:CCGGCCTTACTTCGAAGGATCATAACTCGAGTTATGATCCTTCGAAGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017753.2-774s21c1
Sequence:CCGGCAAGCGCACCACCAGTTTATACTCGAGTATAAACTGGTGGTGCGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017753.2-1220s21c1
Sequence:CCGGTGCGTCCATGACCGAAGTTACCTCGAGGTAACTTCGGTCATGGACGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017753.2-889s21c1
Sequence:CCGGCCTTATATGCCACGATGTATACTCGAGTATACATCGTGGCATATAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017753.2-887s1c1
Sequence:CCGGCGCCTTATATGCCACGATGTACTCGAGTACATCGTGGCATATAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017753.2-1182s1c1
Sequence:CCGGGAAAGCCCTCTGGAAACCTTACTCGAGTAAGGTTTCCAGAGGGCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017753.2-599s1c1
Sequence:CCGGCGGAGAATGCTGTTACCTGAACTCGAGTTCAGGTAACAGCATTCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017753.2-873s1c1
Sequence:CCGGCTGAGCATTTACTCCGCCTTACTCGAGTAAGGCGGAGTAAATGCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017753.2-422s1c1
Sequence:CCGGCGGAGACTTAATGAAGCCTTACTCGAGTAAGGCTTCATTAAGTCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017753
LPPR1 MISSION shRNA shRNA Plasmid DNA
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000359523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017753.2-622s21c1
Sequence:CCGGCCTTACTTCGAAGGATCATAACTCGAGTTATGATCCTTCGAAGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017753.2-774s21c1
Sequence:CCGGCAAGCGCACCACCAGTTTATACTCGAGTATAAACTGGTGGTGCGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017753.2-1220s21c1
Sequence:CCGGTGCGTCCATGACCGAAGTTACCTCGAGGTAACTTCGGTCATGGACGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017753.2-889s21c1
Sequence:CCGGCCTTATATGCCACGATGTATACTCGAGTATACATCGTGGCATATAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017753.2-887s1c1
Sequence:CCGGCGCCTTATATGCCACGATGTACTCGAGTACATCGTGGCATATAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017753.2-1182s1c1
Sequence:CCGGGAAAGCCCTCTGGAAACCTTACTCGAGTAAGGTTTCCAGAGGGCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017753.2-599s1c1
Sequence:CCGGCGGAGAATGCTGTTACCTGAACTCGAGTTCAGGTAACAGCATTCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017753.2-873s1c1
Sequence:CCGGCTGAGCATTTACTCCGCCTTACTCGAGTAAGGCGGAGTAAATGCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017753.2-422s1c1
Sequence:CCGGCGGAGACTTAATGAAGCCTTACTCGAGTAAGGCTTCATTAAGTCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017753
LPPR1 MISSION shRNA Lentiviral Transduction Particles
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000359523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017753.2-622s21c1
Sequence:CCGGCCTTACTTCGAAGGATCATAACTCGAGTTATGATCCTTCGAAGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017753.2-774s21c1
Sequence:CCGGCAAGCGCACCACCAGTTTATACTCGAGTATAAACTGGTGGTGCGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017753.2-1220s21c1
Sequence:CCGGTGCGTCCATGACCGAAGTTACCTCGAGGTAACTTCGGTCATGGACGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017753.2-889s21c1
Sequence:CCGGCCTTATATGCCACGATGTATACTCGAGTATACATCGTGGCATATAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017753.2-887s1c1
Sequence:CCGGCGCCTTATATGCCACGATGTACTCGAGTACATCGTGGCATATAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017753.2-1182s1c1
Sequence:CCGGGAAAGCCCTCTGGAAACCTTACTCGAGTAAGGTTTCCAGAGGGCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017753.2-599s1c1
Sequence:CCGGCGGAGAATGCTGTTACCTGAACTCGAGTTCAGGTAACAGCATTCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017753.2-873s1c1
Sequence:CCGGCTGAGCATTTACTCCGCCTTACTCGAGTAAGGCGGAGTAAATGCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017753.2-422s1c1
Sequence:CCGGCGGAGACTTAATGAAGCCTTACTCGAGTAAGGCTTCATTAAGTCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks