EMAIL THIS PAGE TO A FRIEND

LRCH1

leucine-rich repeats and calponin homology (CH) domain containing 1

Synonyms: CHDC1 NP81
Gene ID:
Human(23143) Summary: This gene encodes a protein with a leucine-rich repeat and a calponin homology domain. Polymorphism in this gene may be associated with susceptibililty to knee osteoarthritis. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2010]
Mouse(380916) leucine-rich repeats and calponin homology (CH) domain containing 1
Rat(502020) leucine-rich repeats and calponin homology (CH) domain containing 1
chicken(418855) leucine-rich repeats and calponin homology (CH) domain containing 1
cow(505325) leucine-rich repeats and calponin homology (CH) domain containing 1
Horse(100058140) leucine-rich repeats and calponin homology (CH) domain containing 1
dog(476919) leucine-rich repeats and calponin homology (CH) domain containing 1
naked mole-rat(101709937) leucine-rich repeats and calponin homology (CH) domain containing 1
domestic guinea pig(100714055) leucine-rich repeats and calponin homology (CH) domain containing 1
sheep(101104584) leucine-rich repeats and calponin homology (CH) domain containing 1
195 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015116 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015116 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015116 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001033439 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033439 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033439 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015116 Rosetta Predictions human pricing
NM_001134727 Rosetta Predictions rat pricing
NM_001033439 Rosetta Predictions mouse pricing
XM_001001891 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015116 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00206712 predicted 2130
2 SASI_Hs01_00206713 predicted 1997
3 SASI_Hs01_00206714 predicted 1044
4 SASI_Hs01_00206715 predicted 995
5 SASI_Hs01_00206716 predicted 1525
6 SASI_Hs01_00206717 predicted 953
7 SASI_Hs01_00206718 predicted 2226
8 SASI_Hs01_00206719 predicted 2390
9 SASI_Hs01_00206720 predicted 746
10 SASI_Hs01_00206721 predicted 802
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134727 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00258184 predicted 1137
2 SASI_Rn02_00258185 predicted 1514
3 SASI_Rn02_00258186 predicted 1330
4 SASI_Rn02_00258187 predicted 1577
5 SASI_Rn02_00258188 predicted 1528
6 SASI_Rn02_00258189 predicted 1002
7 SASI_Rn02_00258190 predicted 479
8 SASI_Rn02_00258191 predicted 705
9 SASI_Rn02_00258192 predicted 288
10 SASI_Rn02_00258193 predicted 1306
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033439 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00085491 predicted 1633
2 SASI_Mm01_00085492 predicted 1201
3 SASI_Mm01_00085494 predicted 1220
4 SASI_Mm01_00085495 predicted 1216
5 SASI_Mm01_00085496 predicted 1436
6 SASI_Mm02_00288760 predicted 604
7 SASI_Mm01_00085497 predicted 1169
8 SASI_Mm01_00085498 predicted 1735
9 SASI_Mm01_00085499 predicted 885
10 SASI_Mm01_00085500 predicted 1305
11 SASI_Mm01_00085493 predicted 1027
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001001891 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00250165 predicted 1768
2 SASI_Mm01_00250166 predicted 1337
3 SASI_Mm01_00250167 predicted 1155
4 SASI_Mm01_00250168 predicted 1354
5 SASI_Mm01_00250169 predicted 1353
6 SASI_Mm01_00250170 predicted 1569
7 SASI_Mm01_00250171 predicted 1305
8 SASI_Mm01_00250172 predicted 1866
9 SASI_Mm01_00250173 predicted 1016
10 SASI_Mm01_00250174 predicted 1446
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015116
LRCH1 MISSION shRNA Bacterial Glycerol Stock
leucine-rich repeats and calponin homology (CH) domain containing 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130888    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015116.1-2333s1c1
Sequence:CCGGGACCTTATAGGCTTCTGTCTTCTCGAGAAGACAGAAGCCTATAAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015116.1-1924s1c1
Sequence:CCGGGCAGTTTACAATCCGGAGGAACTCGAGTTCCTCCGGATTGTAAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128103    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015116.1-1925s1c1
Sequence:CCGGCAGTTTACAATCCGGAGGAAACTCGAGTTTCCTCCGGATTGTAAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128436    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015116.1-2902s1c1
Sequence:CCGGGCCCAACTTGATCTATACAAACTCGAGTTTGTATAGATCAAGTTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129283    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015116.1-2471s1c1
Sequence:CCGGCCTTCCTACCTTTGAGCCTTTCTCGAGAAAGGCTCAAAGGTAGGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015116.1-1398s1c1
Sequence:CCGGGCACCAACTCAGGAGAAGAAACTCGAGTTTCTTCTCCTGAGTTGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015116.1-1791s1c1
Sequence:CCGGGCCAGTATTCTCCAAATGAGACTCGAGTCTCATTTGGAGAATACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015116.2-1534s21c1
Sequence:CCAGGGCAAACTGAGGGCATAATAACTCGAGTTATTATGCCCTCAGTTTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015116.2-2404s21c1
Sequence:CCGGGGAATGCTCTGTCCGCATAATCTCGAGATTATGCGGACAGAGCATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015116.2-676s21c1
Sequence:CCGGACCTGAACTTGAGTCGAAATCCTCGAGGATTTCGACTCAAGTTCAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015116
LRCH1 MISSION shRNA shRNA Plasmid DNA
leucine-rich repeats and calponin homology (CH) domain containing 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130888    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015116.1-2333s1c1
Sequence:CCGGGACCTTATAGGCTTCTGTCTTCTCGAGAAGACAGAAGCCTATAAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015116.1-1924s1c1
Sequence:CCGGGCAGTTTACAATCCGGAGGAACTCGAGTTCCTCCGGATTGTAAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128103    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015116.1-1925s1c1
Sequence:CCGGCAGTTTACAATCCGGAGGAAACTCGAGTTTCCTCCGGATTGTAAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128436    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015116.1-2902s1c1
Sequence:CCGGGCCCAACTTGATCTATACAAACTCGAGTTTGTATAGATCAAGTTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129283    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015116.1-2471s1c1
Sequence:CCGGCCTTCCTACCTTTGAGCCTTTCTCGAGAAAGGCTCAAAGGTAGGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015116.1-1398s1c1
Sequence:CCGGGCACCAACTCAGGAGAAGAAACTCGAGTTTCTTCTCCTGAGTTGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015116.1-1791s1c1
Sequence:CCGGGCCAGTATTCTCCAAATGAGACTCGAGTCTCATTTGGAGAATACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015116.2-1534s21c1
Sequence:CCAGGGCAAACTGAGGGCATAATAACTCGAGTTATTATGCCCTCAGTTTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015116.2-2404s21c1
Sequence:CCGGGGAATGCTCTGTCCGCATAATCTCGAGATTATGCGGACAGAGCATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015116.2-676s21c1
Sequence:CCGGACCTGAACTTGAGTCGAAATCCTCGAGGATTTCGACTCAAGTTCAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015116
LRCH1 MISSION shRNA Lentiviral Transduction Particles
leucine-rich repeats and calponin homology (CH) domain containing 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130888    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015116.1-2333s1c1
Sequence:CCGGGACCTTATAGGCTTCTGTCTTCTCGAGAAGACAGAAGCCTATAAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015116.1-1924s1c1
Sequence:CCGGGCAGTTTACAATCCGGAGGAACTCGAGTTCCTCCGGATTGTAAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128103    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015116.1-1925s1c1
Sequence:CCGGCAGTTTACAATCCGGAGGAAACTCGAGTTTCCTCCGGATTGTAAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128436    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015116.1-2902s1c1
Sequence:CCGGGCCCAACTTGATCTATACAAACTCGAGTTTGTATAGATCAAGTTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129283    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015116.1-2471s1c1
Sequence:CCGGCCTTCCTACCTTTGAGCCTTTCTCGAGAAAGGCTCAAAGGTAGGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015116.1-1398s1c1
Sequence:CCGGGCACCAACTCAGGAGAAGAAACTCGAGTTTCTTCTCCTGAGTTGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015116.1-1791s1c1
Sequence:CCGGGCCAGTATTCTCCAAATGAGACTCGAGTCTCATTTGGAGAATACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015116.2-1534s21c1
Sequence:CCAGGGCAAACTGAGGGCATAATAACTCGAGTTATTATGCCCTCAGTTTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015116.2-2404s21c1
Sequence:CCGGGGAATGCTCTGTCCGCATAATCTCGAGATTATGCGGACAGAGCATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015116.2-676s21c1
Sequence:CCGGACCTGAACTTGAGTCGAAATCCTCGAGGATTTCGACTCAAGTTCAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033439
LRCH1 MISSION shRNA Bacterial Glycerol Stock
leucine-rich repeats and calponin homology (CH) domain containing 1
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000251155    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033439.2-4408s21c1
Sequence:CCGGTGAAGCTCAGTAACCATTATTCTCGAGAATAATGGTTACTGAGCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033439.2-1570s21c1
Sequence:CCGGCAACGGTCTAAGCGCAGATATCTCGAGATATCTGCGCTTAGACCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033439.2-485s21c1
Sequence:CCGGGTTCGGGCAGATCTATCTAAACTCGAGTTTAGATAGATCTGCCCGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033439.2-1400s21c1
Sequence:CCGGTCGGGACTTATGAACTATATTCTCGAGAATATAGTTCATAAGTCCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033439
LRCH1 MISSION shRNA shRNA Plasmid DNA
leucine-rich repeats and calponin homology (CH) domain containing 1
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000251155    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033439.2-4408s21c1
Sequence:CCGGTGAAGCTCAGTAACCATTATTCTCGAGAATAATGGTTACTGAGCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033439.2-1570s21c1
Sequence:CCGGCAACGGTCTAAGCGCAGATATCTCGAGATATCTGCGCTTAGACCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033439.2-485s21c1
Sequence:CCGGGTTCGGGCAGATCTATCTAAACTCGAGTTTAGATAGATCTGCCCGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033439.2-1400s21c1
Sequence:CCGGTCGGGACTTATGAACTATATTCTCGAGAATATAGTTCATAAGTCCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033439
LRCH1 MISSION shRNA Lentiviral Transduction Particles
leucine-rich repeats and calponin homology (CH) domain containing 1
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000251155    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033439.2-4408s21c1
Sequence:CCGGTGAAGCTCAGTAACCATTATTCTCGAGAATAATGGTTACTGAGCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033439.2-1570s21c1
Sequence:CCGGCAACGGTCTAAGCGCAGATATCTCGAGATATCTGCGCTTAGACCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033439.2-485s21c1
Sequence:CCGGGTTCGGGCAGATCTATCTAAACTCGAGTTTAGATAGATCTGCCCGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033439.2-1400s21c1
Sequence:CCGGTCGGGACTTATGAACTATATTCTCGAGAATATAGTTCATAAGTCCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks