EMAIL THIS PAGE TO A FRIEND

LRFN2

leucine rich repeat and fibronectin type III domain containing 2

Synonyms: FIGLER2 KIAA1246 RP11-535K1.2 SALM1
UniProtKB ID: Q9ULH4, A5PKU3, Q5SYP9
Gene ID:
Mouse(70530) leucine rich repeat and fibronectin type III domain containing 2
Rat(316205) leucine rich repeat and fibronectin type III domain containing 2
Zebrafish(558484) leucine rich repeat and fibronectin type III domain containing 2
cow(524447) leucine rich repeat and fibronectin type III domain containing 2
Horse(100065821) leucine rich repeat and fibronectin type III domain containing 2
domestic cat(101086973) leucine rich repeat and fibronectin type III domain containing 2
dog(481785) leucine rich repeat and fibronectin type III domain containing 2
chicken(428571) leucine rich repeat and fibronectin type III domain containing 2
sheep(101107233) leucine rich repeat and fibronectin type III domain containing 2
naked mole-rat(101722867) leucine rich repeat and fibronectin type III domain containing 2
domestic guinea pig(100721818) leucine rich repeat and fibronectin type III domain containing 2
60 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020737 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020737 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020737 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027452 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027452 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027452 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020737 Rosetta Predictions human pricing
NM_001039699 Rosetta Predictions rat pricing
NM_027452 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020737 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00017684 predicted 2040
2 SASI_Hs01_00017685 predicted 1269
3 SASI_Hs01_00017687 predicted 1344
4 SASI_Hs01_00017688 predicted 653
5 SASI_Hs01_00017689 predicted 2262
6 SASI_Hs01_00017690 predicted 2130
7 SASI_Hs02_00353832 predicted 2007
8 SASI_Hs01_00017691 predicted 1160
9 SASI_Hs01_00017692 predicted 2890
10 SASI_Hs01_00017693 predicted 1184
11 SASI_Hs01_00017686 predicted 2694
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039699 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00204873 predicted 2427
2 SASI_Rn02_00204874 predicted 411
3 SASI_Rn02_00204875 predicted 879
4 SASI_Rn02_00204876 predicted 918
5 SASI_Rn02_00204877 predicted 821
6 SASI_Rn02_00204878 predicted 1030
7 SASI_Rn02_00204879 predicted 1182
8 SASI_Rn02_00204880 predicted 247
9 SASI_Rn02_00204881 predicted 2229
10 SASI_Rn02_00204882 predicted 2342
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027452 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00101696 predicted 2024
2 SASI_Mm01_00101697 predicted 1574
3 SASI_Mm02_00332217 predicted 656
4 SASI_Mm01_00101699 predicted 1348
5 SASI_Mm01_00101700 predicted 1000
6 SASI_Mm01_00101701 predicted 1654
7 SASI_Mm01_00101703 predicted 1271
8 SASI_Mm01_00101704 predicted 2278
9 SASI_Mm01_00101705 predicted 1022
10 SASI_Mm02_00332218 predicted 1493
11 SASI_Mm01_00101698 predicted 2917
12 SASI_Mm01_00101702 predicted 1838
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020737
LRFN2 MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat and fibronectin type III domain containing 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000431133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020737.1-1842s21c1
Sequence:CCGGTGACGATGAGGTACTGATTTACTCGAGTAAATCAGTACCTCATCGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020737.1-1469s21c1
Sequence:CCGGGGACCGCTGTCTATGACAATGCTCGAGCATTGTCATAGACAGCGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414927    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020737.1-2911s21c1
Sequence:CCGGGAGTTTCCATGGTGATGTTTACTCGAGTAAACATCACCATGGAAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020737.1-2457s1c1
Sequence:CCGGCCTCAAGAGTCAGAGAAAGGACTCGAGTCCTTTCTCTGACTCTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020737.1-843s1c1
Sequence:CCGGGCAGCACCTTATCGTGAACAACTCGAGTTGTTCACGATAAGGTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020737.1-1187s1c1
Sequence:CCGGGTAACCCACTTCACTGCAATTCTCGAGAATTGCAGTGAAGTGGGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152563    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020737.1-2887s1c1
Sequence:CCGGGAATCTCACTGGCAAGTGTTTCTCGAGAAACACTTGCCAGTGAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154313    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020737.1-2942s1c1
Sequence:CCGGCAGTTTCGTCTCCCTGTCAATCTCGAGATTGACAGGGAGACGAAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020737
LRFN2 MISSION shRNA shRNA Plasmid DNA
leucine rich repeat and fibronectin type III domain containing 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000431133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020737.1-1842s21c1
Sequence:CCGGTGACGATGAGGTACTGATTTACTCGAGTAAATCAGTACCTCATCGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020737.1-1469s21c1
Sequence:CCGGGGACCGCTGTCTATGACAATGCTCGAGCATTGTCATAGACAGCGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414927    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020737.1-2911s21c1
Sequence:CCGGGAGTTTCCATGGTGATGTTTACTCGAGTAAACATCACCATGGAAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020737.1-2457s1c1
Sequence:CCGGCCTCAAGAGTCAGAGAAAGGACTCGAGTCCTTTCTCTGACTCTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020737.1-843s1c1
Sequence:CCGGGCAGCACCTTATCGTGAACAACTCGAGTTGTTCACGATAAGGTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020737.1-1187s1c1
Sequence:CCGGGTAACCCACTTCACTGCAATTCTCGAGAATTGCAGTGAAGTGGGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152563    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020737.1-2887s1c1
Sequence:CCGGGAATCTCACTGGCAAGTGTTTCTCGAGAAACACTTGCCAGTGAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154313    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020737.1-2942s1c1
Sequence:CCGGCAGTTTCGTCTCCCTGTCAATCTCGAGATTGACAGGGAGACGAAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020737
LRFN2 MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat and fibronectin type III domain containing 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000431133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020737.1-1842s21c1
Sequence:CCGGTGACGATGAGGTACTGATTTACTCGAGTAAATCAGTACCTCATCGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020737.1-1469s21c1
Sequence:CCGGGGACCGCTGTCTATGACAATGCTCGAGCATTGTCATAGACAGCGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414927    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020737.1-2911s21c1
Sequence:CCGGGAGTTTCCATGGTGATGTTTACTCGAGTAAACATCACCATGGAAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020737.1-2457s1c1
Sequence:CCGGCCTCAAGAGTCAGAGAAAGGACTCGAGTCCTTTCTCTGACTCTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020737.1-843s1c1
Sequence:CCGGGCAGCACCTTATCGTGAACAACTCGAGTTGTTCACGATAAGGTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020737.1-1187s1c1
Sequence:CCGGGTAACCCACTTCACTGCAATTCTCGAGAATTGCAGTGAAGTGGGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152563    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020737.1-2887s1c1
Sequence:CCGGGAATCTCACTGGCAAGTGTTTCTCGAGAAACACTTGCCAGTGAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154313    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020737.1-2942s1c1
Sequence:CCGGCAGTTTCGTCTCCCTGTCAATCTCGAGATTGACAGGGAGACGAAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027452
LRFN2 MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat and fibronectin type III domain containing 2
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000217358    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027452.2-835s1c1
Sequence:CCGGGTCAACCTGCAACACCTTATTCTCGAGAATAAGGTGTTGCAGGTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216833    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027452.2-1490s1c1
Sequence:CCGGGCACCCTGGACATTCTAATTACTCGAGTAATTAGAATGTCCAGGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194422    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027452.1-2804s1c1
Sequence:CCGGCAGAGTGGGTAATGGAAAGTACTCGAGTACTTTCCATTACCCACTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027452.1-2470s1c1
Sequence:CCGGCAAAGGAAAGAAGAACTTCTACTCGAGTAGAAGTTCTTCTTTCCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027452.1-2031s1c1
Sequence:CCGGCCAGTCTATGCACAGTCAGATCTCGAGATCTGACTGTGCATAGACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027452.1-930s1c1
Sequence:CCGGCCTATCTTACAACAACCTCCACTCGAGTGGAGGTTGTTGTAAGATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027452.1-2067s1c1
Sequence:CCGGGATTCTGGTCATCGGAGGTATCTCGAGATACCTCCGATGACCAGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027452
LRFN2 MISSION shRNA shRNA Plasmid DNA
leucine rich repeat and fibronectin type III domain containing 2
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000217358    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027452.2-835s1c1
Sequence:CCGGGTCAACCTGCAACACCTTATTCTCGAGAATAAGGTGTTGCAGGTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216833    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027452.2-1490s1c1
Sequence:CCGGGCACCCTGGACATTCTAATTACTCGAGTAATTAGAATGTCCAGGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194422    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027452.1-2804s1c1
Sequence:CCGGCAGAGTGGGTAATGGAAAGTACTCGAGTACTTTCCATTACCCACTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027452.1-2470s1c1
Sequence:CCGGCAAAGGAAAGAAGAACTTCTACTCGAGTAGAAGTTCTTCTTTCCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027452.1-2031s1c1
Sequence:CCGGCCAGTCTATGCACAGTCAGATCTCGAGATCTGACTGTGCATAGACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027452.1-930s1c1
Sequence:CCGGCCTATCTTACAACAACCTCCACTCGAGTGGAGGTTGTTGTAAGATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027452.1-2067s1c1
Sequence:CCGGGATTCTGGTCATCGGAGGTATCTCGAGATACCTCCGATGACCAGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027452
LRFN2 MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat and fibronectin type III domain containing 2
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000217358    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027452.2-835s1c1
Sequence:CCGGGTCAACCTGCAACACCTTATTCTCGAGAATAAGGTGTTGCAGGTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216833    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027452.2-1490s1c1
Sequence:CCGGGCACCCTGGACATTCTAATTACTCGAGTAATTAGAATGTCCAGGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194422    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027452.1-2804s1c1
Sequence:CCGGCAGAGTGGGTAATGGAAAGTACTCGAGTACTTTCCATTACCCACTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027452.1-2470s1c1
Sequence:CCGGCAAAGGAAAGAAGAACTTCTACTCGAGTAGAAGTTCTTCTTTCCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027452.1-2031s1c1
Sequence:CCGGCCAGTCTATGCACAGTCAGATCTCGAGATCTGACTGTGCATAGACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027452.1-930s1c1
Sequence:CCGGCCTATCTTACAACAACCTCCACTCGAGTGGAGGTTGTTGTAAGATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027452.1-2067s1c1
Sequence:CCGGGATTCTGGTCATCGGAGGTATCTCGAGATACCTCCGATGACCAGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks