EMAIL THIS PAGE TO A FRIEND

LRFN4

leucine rich repeat and fibronectin type III domain containing 4

Synonyms: FIGLER6 SALM3 SALM3.
UniProtKB ID: Q6PJG9, Q4VBZ3, Q59GV4, Q8N644, Q9BWJ0
Gene ID:
Mouse(225875) leucine rich repeat and fibronectin type III domain containing 4
Rat(688721) leucine rich repeat and fibronectin type III domain containing 4
cow(530084) leucine rich repeat and fibronectin type III domain containing 4
Horse(100058809) leucine rich repeat and fibronectin type III domain containing 4
domestic cat(101089801) leucine rich repeat and fibronectin type III domain containing 4
dog(610605) leucine rich repeat and fibronectin type III domain containing 4
naked mole-rat(101711187) leucine rich repeat and fibronectin type III domain containing 4
domestic guinea pig(100719775) leucine rich repeat and fibronectin type III domain containing 4
54 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB3500019 Anti-LRFN4 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human, mouse, rat
ELISA, immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153388 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153388 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153388 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_024036 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024036 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024036 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024036 Rosetta Predictions human pricing
NM_001109508 Rosetta Predictions rat pricing
NM_153388 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024036 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00087948 predicted 756
2 SASI_Hs01_00087949 predicted 751
3 SASI_Hs01_00087950 predicted 1562
4 SASI_Hs01_00087951 predicted 655
5 SASI_Hs01_00087952 predicted 1528
6 SASI_Hs01_00087953 predicted 465
7 SASI_Hs01_00087954 predicted 1281
8 SASI_Hs01_00087955 predicted 768
9 SASI_Hs01_00087956 predicted 482
10 SASI_Hs01_00087957 predicted 550
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109508 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00249089 predicted 1443
2 SASI_Rn02_00249090 predicted 463
3 SASI_Rn02_00249091 predicted 1630
4 SASI_Rn02_00249092 predicted 1098
5 SASI_Rn02_00249093 predicted 1385
6 SASI_Rn02_00249094 predicted 1464
7 SASI_Rn02_00249095 predicted 1803
8 SASI_Rn02_00249096 predicted 1054
9 SASI_Rn02_00249097 predicted 585
10 SASI_Rn02_00249098 predicted 601
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153388 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00343154 predicted 2560
2 SASI_Mm02_00343155 predicted 1288
3 SASI_Mm02_00343156 predicted 2458
4 SASI_Mm02_00343157 predicted 2278
5 SASI_Mm02_00343158 predicted 1403
6 SASI_Mm02_00343159 predicted 2214
7 SASI_Mm02_00343160 predicted 2156
8 SASI_Mm02_00343161 predicted 1364
9 SASI_Mm02_00343162 predicted 2291
10 SASI_Mm02_00343163 predicted 1920
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153388
LRFN4 MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat and fibronectin type III domain containing 4
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000445603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153388.4-2613s21c1
Sequence:CCGGAGAGTGTGGTGTGACAGAAAGCTCGAGCTTTCTGTCACACCACACTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435191    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153388.4-909s21c1
Sequence:CCGGCACCTGACTTCCGCAACATGACTCGAGTCATGTTGCGGAAGTCAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153388.4-2049s21c1
Sequence:CCGGAGACCCTCATCTACCGGATTGCTCGAGCAATCCGGTAGATGAGGGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153388.2-1224s1c1
Sequence:CCGGGACCTAACATTGTCTCGAAATCTCGAGATTTCGAGACAATGTTAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153388.2-2196s1c1
Sequence:CCGGGAGGGAACTTTAGAATCTGAACTCGAGTTCAGATTCTAAAGTTCCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153388.2-1367s1c1
Sequence:CCGGGCATCTCATTCTCAGTGGCAACTCGAGTTGCCACTGAGAATGAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153388.2-2195s1c1
Sequence:CCGGCGAGGGAACTTTAGAATCTGACTCGAGTCAGATTCTAAAGTTCCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153388
LRFN4 MISSION shRNA shRNA Plasmid DNA
leucine rich repeat and fibronectin type III domain containing 4
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000445603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153388.4-2613s21c1
Sequence:CCGGAGAGTGTGGTGTGACAGAAAGCTCGAGCTTTCTGTCACACCACACTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435191    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153388.4-909s21c1
Sequence:CCGGCACCTGACTTCCGCAACATGACTCGAGTCATGTTGCGGAAGTCAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153388.4-2049s21c1
Sequence:CCGGAGACCCTCATCTACCGGATTGCTCGAGCAATCCGGTAGATGAGGGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153388.2-1224s1c1
Sequence:CCGGGACCTAACATTGTCTCGAAATCTCGAGATTTCGAGACAATGTTAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153388.2-2196s1c1
Sequence:CCGGGAGGGAACTTTAGAATCTGAACTCGAGTTCAGATTCTAAAGTTCCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153388.2-1367s1c1
Sequence:CCGGGCATCTCATTCTCAGTGGCAACTCGAGTTGCCACTGAGAATGAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153388.2-2195s1c1
Sequence:CCGGCGAGGGAACTTTAGAATCTGACTCGAGTCAGATTCTAAAGTTCCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153388
LRFN4 MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat and fibronectin type III domain containing 4
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000445603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153388.4-2613s21c1
Sequence:CCGGAGAGTGTGGTGTGACAGAAAGCTCGAGCTTTCTGTCACACCACACTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435191    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153388.4-909s21c1
Sequence:CCGGCACCTGACTTCCGCAACATGACTCGAGTCATGTTGCGGAAGTCAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153388.4-2049s21c1
Sequence:CCGGAGACCCTCATCTACCGGATTGCTCGAGCAATCCGGTAGATGAGGGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153388.2-1224s1c1
Sequence:CCGGGACCTAACATTGTCTCGAAATCTCGAGATTTCGAGACAATGTTAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153388.2-2196s1c1
Sequence:CCGGGAGGGAACTTTAGAATCTGAACTCGAGTTCAGATTCTAAAGTTCCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153388.2-1367s1c1
Sequence:CCGGGCATCTCATTCTCAGTGGCAACTCGAGTTGCCACTGAGAATGAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153388.2-2195s1c1
Sequence:CCGGCGAGGGAACTTTAGAATCTGACTCGAGTCAGATTCTAAAGTTCCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024036
VALIDATED
LRFN4 MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat and fibronectin type III domain containing 4
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024036.4-754s21c1
Sequence:CCGGAGCCTTCGACGACTTCCTAGACTCGAGTCTAGGAAGTCGTCGAAGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415086    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024036.4-700s21c1
Sequence:CCGGCAATCTGCAGCACCTCATCCTCTCGAGAGGATGAGGTGCTGCAGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024036.4-2004s21c1
Sequence:CCGGACGTCCAGTCCCAGACCAATGCTCGAGCATTGGTCTGGGACTGGACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024036.4-1335s21c1
Sequence:CCGGCCAACGGGACCTTAGAGATTGCTCGAGCAATCTCTAAGGTCCCGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062880    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024036.3-774s1c1
Sequence:CCGGCCATAACCTTATTGACGCACTCTCGAGAGTGCGTCAATAAGGTTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024036
VALIDATED
LRFN4 MISSION shRNA shRNA Plasmid DNA
leucine rich repeat and fibronectin type III domain containing 4
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024036.4-754s21c1
Sequence:CCGGAGCCTTCGACGACTTCCTAGACTCGAGTCTAGGAAGTCGTCGAAGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415086    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024036.4-700s21c1
Sequence:CCGGCAATCTGCAGCACCTCATCCTCTCGAGAGGATGAGGTGCTGCAGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024036.4-2004s21c1
Sequence:CCGGACGTCCAGTCCCAGACCAATGCTCGAGCATTGGTCTGGGACTGGACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024036.4-1335s21c1
Sequence:CCGGCCAACGGGACCTTAGAGATTGCTCGAGCAATCTCTAAGGTCCCGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062880    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024036.3-774s1c1
Sequence:CCGGCCATAACCTTATTGACGCACTCTCGAGAGTGCGTCAATAAGGTTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024036
VALIDATED
LRFN4 MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat and fibronectin type III domain containing 4
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024036.4-754s21c1
Sequence:CCGGAGCCTTCGACGACTTCCTAGACTCGAGTCTAGGAAGTCGTCGAAGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415086    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024036.4-700s21c1
Sequence:CCGGCAATCTGCAGCACCTCATCCTCTCGAGAGGATGAGGTGCTGCAGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024036.4-2004s21c1
Sequence:CCGGACGTCCAGTCCCAGACCAATGCTCGAGCATTGGTCTGGGACTGGACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024036.4-1335s21c1
Sequence:CCGGCCAACGGGACCTTAGAGATTGCTCGAGCAATCTCTAAGGTCCCGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062880    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024036.3-774s1c1
Sequence:CCGGCCATAACCTTATTGACGCACTCTCGAGAGTGCGTCAATAAGGTTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks