EMAIL THIS PAGE TO A FRIEND

LRP5L

low density lipoprotein receptor-related protein 5-like

Species: Human LRP5L(91355)
UniProtKB ID: A4QPB2, B0QYF3, B0QYF4, B2RPI5
Gene ID:
28 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_182492 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182492 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182492 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU026201 MISSION® esiRNA esiRNA human LRP5L (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_182492 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182492 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00109602 predicted 2776
2 SASI_Hs01_00109603 predicted 2888
3 SASI_Hs01_00109604 predicted 3015
4 SASI_Hs01_00109606 predicted 3121
5 SASI_Hs01_00109607 predicted 2546
6 SASI_Hs01_00109608 predicted 2904
7 SASI_Hs01_00109609 predicted 2508
8 SASI_Hs01_00109610 predicted 2727
9 SASI_Hs01_00109611 predicted 2716
10 SASI_Hs02_00370531 predicted 2878
11 SASI_Hs01_00109605 predicted 2761
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182492
LRP5L MISSION shRNA Bacterial Glycerol Stock
low density lipoprotein receptor-related protein 5-like
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000244641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182492.2-2572s21c1
Sequence:CCGGCCGATGACATCGCAGTCAACTCTCGAGAGTTGACTGCGATGTCATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182492.2-2909s21c1
Sequence:CCGGCAGTGTCGATGAGACGAAGAGCTCGAGCTCTTCGTCTCATCGACACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244644    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182492.2-3430s21c1
Sequence:CCGGTGCACACGTGCAGCCTATATGCTCGAGCATATAGGCTGCACGTGTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182492.2-2540s21c1
Sequence:CCGGGCAGACGCTGATCAACACCAACTCGAGTTGGTGTTGATCAGCGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149335    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182492.1-2548s1c1
Sequence:CCGGGCTGATCAACACCAAGATCAACTCGAGTTGATCTTGGTGTTGATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180533    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182492.1-2545s1c1
Sequence:CCGGGACGCTGATCAACACCAAGATCTCGAGATCTTGGTGTTGATCAGCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180178    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182492.1-2547s1c1
Sequence:CCGGCGCTGATCAACACCAAGATCACTCGAGTGATCTTGGTGTTGATCAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182492
LRP5L MISSION shRNA shRNA Plasmid DNA
low density lipoprotein receptor-related protein 5-like
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000244641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182492.2-2572s21c1
Sequence:CCGGCCGATGACATCGCAGTCAACTCTCGAGAGTTGACTGCGATGTCATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182492.2-2909s21c1
Sequence:CCGGCAGTGTCGATGAGACGAAGAGCTCGAGCTCTTCGTCTCATCGACACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244644    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182492.2-3430s21c1
Sequence:CCGGTGCACACGTGCAGCCTATATGCTCGAGCATATAGGCTGCACGTGTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182492.2-2540s21c1
Sequence:CCGGGCAGACGCTGATCAACACCAACTCGAGTTGGTGTTGATCAGCGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149335    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182492.1-2548s1c1
Sequence:CCGGGCTGATCAACACCAAGATCAACTCGAGTTGATCTTGGTGTTGATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180533    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182492.1-2545s1c1
Sequence:CCGGGACGCTGATCAACACCAAGATCTCGAGATCTTGGTGTTGATCAGCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180178    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182492.1-2547s1c1
Sequence:CCGGCGCTGATCAACACCAAGATCACTCGAGTGATCTTGGTGTTGATCAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182492
LRP5L MISSION shRNA Lentiviral Transduction Particles
low density lipoprotein receptor-related protein 5-like
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000244641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182492.2-2572s21c1
Sequence:CCGGCCGATGACATCGCAGTCAACTCTCGAGAGTTGACTGCGATGTCATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182492.2-2909s21c1
Sequence:CCGGCAGTGTCGATGAGACGAAGAGCTCGAGCTCTTCGTCTCATCGACACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244644    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182492.2-3430s21c1
Sequence:CCGGTGCACACGTGCAGCCTATATGCTCGAGCATATAGGCTGCACGTGTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182492.2-2540s21c1
Sequence:CCGGGCAGACGCTGATCAACACCAACTCGAGTTGGTGTTGATCAGCGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149335    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182492.1-2548s1c1
Sequence:CCGGGCTGATCAACACCAAGATCAACTCGAGTTGATCTTGGTGTTGATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180533    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182492.1-2545s1c1
Sequence:CCGGGACGCTGATCAACACCAAGATCTCGAGATCTTGGTGTTGATCAGCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180178    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182492.1-2547s1c1
Sequence:CCGGCGCTGATCAACACCAAGATCACTCGAGTGATCTTGGTGTTGATCAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks