EMAIL THIS PAGE TO A FRIEND

LRRC17

leucine rich repeat containing 17

Synonyms: P37NB
UniProtKB ID: Q8N6Y2, Q13288, Q6UWA7, Q75MG5
Gene ID:
Mouse(74511) leucine rich repeat containing 17
Rat(502715) leucine rich repeat containing 17
Zebrafish(321202) leucine rich repeat containing 17
chicken(395440) leucine rich repeat containing 17
cow(777690) leucine rich repeat containing 17
Horse(100050177) leucine rich repeat containing 17
dog(100685094) leucine rich repeat containing 17
domestic guinea pig(100728522) leucine rich repeat containing 17
naked mole-rat(101726213) leucine rich repeat containing 17
sheep(101118781) leucine rich repeat containing 17
113 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005824 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005824 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005824 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001031692 Rosetta Predictions human pricing
NM_005824 Rosetta Predictions human pricing
NM_001025155 Rosetta Predictions rat pricing
NM_028977 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001031692 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00155649 predicted 527
2 SASI_Hs01_00155651 predicted 339
3 SASI_Hs02_00307703 predicted 334
4 SASI_Hs01_00155652 predicted 492
5 SASI_Hs01_00155653 predicted 418
6 SASI_Hs01_00155655 predicted 592
7 SASI_Hs01_00155656 predicted 321
8 SASI_Hs01_00155657 predicted 601
9 SASI_Hs02_00307704 predicted 438
10 SASI_Hs02_00307705 predicted 423
11 SASI_Hs01_00155650 predicted 522
12 SASI_Hs01_00155654 predicted 428
13 SASI_Hs01_00155658 predicted 549
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005824 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00071843 predicted 541
2 SASI_Hs01_00071845 predicted 356
3 SASI_Hs02_00340348 predicted 348
4 SASI_Hs01_00071846 predicted 508
5 SASI_Hs01_00071847 predicted 436
6 SASI_Hs01_00071849 predicted 601
7 SASI_Hs01_00071850 predicted 329
8 SASI_Hs01_00071851 predicted 613
9 SASI_Hs02_00340349 predicted 452
10 SASI_Hs02_00340350 predicted 431
11 SASI_Hs01_00071844 predicted 531
12 SASI_Hs01_00071848 predicted 449
13 SASI_Hs01_00071852 predicted 560
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025155 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00121415 predicted 851
2 SASI_Rn01_00121416 predicted 1041
3 SASI_Rn01_00121417 predicted 1626
4 SASI_Rn01_00121418 predicted 1622
5 SASI_Rn01_00121419 predicted 1547
6 SASI_Rn01_00121420 predicted 1192
7 SASI_Rn01_00121421 predicted 1318
8 SASI_Rn01_00121422 predicted 1434
9 SASI_Rn01_00121423 predicted 855
10 SASI_Rn01_00121424 predicted 1491
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028977 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00334706 predicted 1270
2 SASI_Mm02_00334707 predicted 313
3 SASI_Mm02_00334708 predicted 1426
4 SASI_Mm02_00334709 predicted 848
5 SASI_Mm02_00334710 predicted 1047
6 SASI_Mm02_00334711 predicted 1116
7 SASI_Mm02_00334712 predicted 1544
8 SASI_Mm02_00334713 predicted 555
9 SASI_Mm02_00334714 predicted 1103
10 SASI_Mm02_00334715 predicted 1416
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005824
LRRC17 MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat containing 17
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000172319    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005824.1-438s1c1
Sequence:CCGGCCGTGTGACGTGTACACATATCTCGAGATATGTGTACACGTCACACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167520    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005824.1-906s1c1
Sequence:CCGGGAACAGTTGTGTAATGAAGAACTCGAGTTCTTCATTACACAACTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166997    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_005824.1-1335s1c1
Sequence:CCGGGCGTATTAGAAGACTTGTATTCTCGAGAATACAAGTCTTCTAATACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243112    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005824.1-1734s21c1
Sequence:CCGGATTAACTGTGTTGCCTATTTACTCGAGTAAATAGGCAACACAGTTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005824.1-787s21c1
Sequence:CCGGGTGAGATAGAAACGCTTATTTCTCGAGAAATAAGCGTTTCTATCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005824.1-743s21c1
Sequence:CCGGCTTGAGCTACCTGCGTCTTTACTCGAGTAAAGACGCAGGTAGCTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005824.1-1098s21c1
Sequence:CCGGCTTGACTTGTCATACAATAAACTCGAGTTTATTGTATGACAAGTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005824.1-712s21c1
Sequence:CCGGTGACGGAGGAAGTGTTCATTTCTCGAGAAATGAACACTTCCTCCGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005824
LRRC17 MISSION shRNA shRNA Plasmid DNA
leucine rich repeat containing 17
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000172319    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005824.1-438s1c1
Sequence:CCGGCCGTGTGACGTGTACACATATCTCGAGATATGTGTACACGTCACACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167520    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005824.1-906s1c1
Sequence:CCGGGAACAGTTGTGTAATGAAGAACTCGAGTTCTTCATTACACAACTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166997    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_005824.1-1335s1c1
Sequence:CCGGGCGTATTAGAAGACTTGTATTCTCGAGAATACAAGTCTTCTAATACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243112    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005824.1-1734s21c1
Sequence:CCGGATTAACTGTGTTGCCTATTTACTCGAGTAAATAGGCAACACAGTTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005824.1-787s21c1
Sequence:CCGGGTGAGATAGAAACGCTTATTTCTCGAGAAATAAGCGTTTCTATCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005824.1-743s21c1
Sequence:CCGGCTTGAGCTACCTGCGTCTTTACTCGAGTAAAGACGCAGGTAGCTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005824.1-1098s21c1
Sequence:CCGGCTTGACTTGTCATACAATAAACTCGAGTTTATTGTATGACAAGTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005824.1-712s21c1
Sequence:CCGGTGACGGAGGAAGTGTTCATTTCTCGAGAAATGAACACTTCCTCCGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005824
LRRC17 MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat containing 17
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000172319    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005824.1-438s1c1
Sequence:CCGGCCGTGTGACGTGTACACATATCTCGAGATATGTGTACACGTCACACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167520    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005824.1-906s1c1
Sequence:CCGGGAACAGTTGTGTAATGAAGAACTCGAGTTCTTCATTACACAACTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166997    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_005824.1-1335s1c1
Sequence:CCGGGCGTATTAGAAGACTTGTATTCTCGAGAATACAAGTCTTCTAATACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243112    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005824.1-1734s21c1
Sequence:CCGGATTAACTGTGTTGCCTATTTACTCGAGTAAATAGGCAACACAGTTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005824.1-787s21c1
Sequence:CCGGGTGAGATAGAAACGCTTATTTCTCGAGAAATAAGCGTTTCTATCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005824.1-743s21c1
Sequence:CCGGCTTGAGCTACCTGCGTCTTTACTCGAGTAAAGACGCAGGTAGCTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005824.1-1098s21c1
Sequence:CCGGCTTGACTTGTCATACAATAAACTCGAGTTTATTGTATGACAAGTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005824.1-712s21c1
Sequence:CCGGTGACGGAGGAAGTGTTCATTTCTCGAGAAATGAACACTTCCTCCGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks