EMAIL THIS PAGE TO A FRIEND

LRRC29

leucine rich repeat containing 29

Synonyms: FBL9 FBXL9
UniProtKB ID: Q8WV35, B2RE92, Q9UKA0
Gene ID:
Human(26231) Summary: This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbls class and, in addition to an F-box, contains 9 tandem leucine-rich repeats. Two transcript variants encoding the same protein have been found for this gene. Other variants may occur, but their full-length natures have not been characterized. [provided by RefSeq, Jul 2008]
Mouse(234684) leucine rich repeat containing 29
Rat(502201) leucine rich repeat containing 29
sheep(101112502) leucine rich repeat containing 29
naked mole-rat(101718528) leucine rich repeat containing 29
domestic guinea pig(100734543) leucine rich repeat containing 29
cow(525426) leucine rich repeat containing 29
dog(489762) leucine rich repeat containing 29
87 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012163 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012163 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012163 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177449 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177449 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177449 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001004055 Rosetta Predictions human pricing
NM_012163 Rosetta Predictions human pricing
XM_001075557 Rosetta Predictions rat pricing
XM_577662 Rosetta Predictions rat pricing
NM_177449 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004055 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00072670 predicted 756
2 SASI_Hs02_00304448 predicted 918
3 SASI_Hs02_00304449 predicted 583
4 SASI_Hs02_00304450 predicted 754
5 SASI_Hs01_00072672 predicted 866
6 SASI_Hs01_00072673 predicted 906
7 SASI_Hs01_00072674 predicted 753
8 SASI_Hs01_00072676 predicted 916
9 SASI_Hs01_00072677 predicted 1046
10 SASI_Hs01_00072678 predicted 915
11 SASI_Hs01_00072671 predicted 638
12 SASI_Hs01_00072675 predicted 523
13 SASI_Hs01_00072679 predicted 1063
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012163 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00221138 predicted 922
2 SASI_Hs02_00343757 predicted 1081
3 SASI_Hs02_00343758 predicted 739
4 SASI_Hs02_00343759 predicted 918
5 SASI_Hs01_00221140 predicted 1028
6 SASI_Hs01_00221141 predicted 1074
7 SASI_Hs01_00221142 predicted 925
8 SASI_Hs01_00221144 predicted 1084
9 SASI_Hs01_00221145 predicted 1202
10 SASI_Hs01_00221146 predicted 1076
11 SASI_Hs01_00221139 predicted 801
12 SASI_Hs01_00221143 predicted 690
13 SASI_Hs01_00221147 predicted 1225
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001075557 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00350238 predicted 280
2 SASI_Rn02_00350239 predicted 650
3 SASI_Rn02_00350240 predicted 1318
4 SASI_Rn02_00350241 predicted 1583
5 SASI_Rn02_00350242 predicted 855
6 SASI_Rn02_00350243 predicted 651
7 SASI_Rn02_00350244 predicted 848
8 SASI_Rn02_00350245 predicted 926
9 SASI_Rn02_00350246 predicted 817
10 SASI_Rn02_00350247 predicted 1556
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_577662 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00406875 predicted 443
2 SASI_Rn02_00406876 predicted 940
3 SASI_Rn02_00406877 predicted 342
4 SASI_Rn02_00406878 predicted 544
5 SASI_Rn02_00406879 predicted 652
6 SASI_Rn02_00406880 predicted 823
7 SASI_Rn02_00406881 predicted 650
8 SASI_Rn02_00406882 predicted 846
9 SASI_Rn02_00406883 predicted 927
10 SASI_Rn02_00406884 predicted 814
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177449 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00347642 predicted 1462
2 SASI_Mm02_00347643 predicted 1186
3 SASI_Mm02_00347644 predicted 1024
4 SASI_Mm02_00347645 predicted 1120
5 SASI_Mm02_00347646 predicted 1201
6 SASI_Mm02_00347647 predicted 1323
7 SASI_Mm02_00347648 predicted 1640
8 SASI_Mm02_00347649 predicted 1462
9 SASI_Mm02_00347650 predicted 1115
10 SASI_Mm02_00347651 predicted 1108
11 SASI_Mm01_00164441 predicted 438
12 SASI_Mm01_00164442 predicted 263
13 SASI_Mm01_00164443 predicted 204
14 SASI_Mm01_00164444 predicted 339
15 SASI_Mm01_00164445 predicted 262
16 SASI_Mm01_00164446 predicted 594
17 SASI_Mm01_00164447 predicted 531
18 SASI_Mm01_00164448 predicted 219
19 SASI_Mm01_00164449 predicted 456
20 SASI_Mm01_00164450 predicted 470
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012163
LRRC29 MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat containing 29
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000425514    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012163.2-1213s21c1
Sequence:CCGGTGGAAATGCTACCTACGTGTTCTCGAGAACACGTAGGTAGCATTTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012163.2-924s21c1
Sequence:CCGGGAGCAGACACTGGATGCTATTCTCGAGAATAGCATCCAGTGTCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022379    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_012163.1-1369s1c1
Sequence:CCGGCTGTGCTGTAAATCCTAAGATCTCGAGATCTTAGGATTTACAGCACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022381    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_012163.1-537s1c1
Sequence:CCGGGATGCCAGTTTAGCCAAGGTGCTCGAGCACCTTGGCTAAACTGGCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012163.1-919s1c1
Sequence:CCGGCTGACCTGACCCTAACACTCTCTCGAGAGAGTGTTAGGGTCAGGTCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012163.1-601s1c1
Sequence:CCGGCAGAACTCACAGACAACGGCTCTCGAGAGCCGTTGTCTGTGAGTTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012163
LRRC29 MISSION shRNA shRNA Plasmid DNA
leucine rich repeat containing 29
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000425514    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012163.2-1213s21c1
Sequence:CCGGTGGAAATGCTACCTACGTGTTCTCGAGAACACGTAGGTAGCATTTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012163.2-924s21c1
Sequence:CCGGGAGCAGACACTGGATGCTATTCTCGAGAATAGCATCCAGTGTCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022379    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_012163.1-1369s1c1
Sequence:CCGGCTGTGCTGTAAATCCTAAGATCTCGAGATCTTAGGATTTACAGCACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022381    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_012163.1-537s1c1
Sequence:CCGGGATGCCAGTTTAGCCAAGGTGCTCGAGCACCTTGGCTAAACTGGCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012163.1-919s1c1
Sequence:CCGGCTGACCTGACCCTAACACTCTCTCGAGAGAGTGTTAGGGTCAGGTCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012163.1-601s1c1
Sequence:CCGGCAGAACTCACAGACAACGGCTCTCGAGAGCCGTTGTCTGTGAGTTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012163
LRRC29 MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat containing 29
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000425514    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012163.2-1213s21c1
Sequence:CCGGTGGAAATGCTACCTACGTGTTCTCGAGAACACGTAGGTAGCATTTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012163.2-924s21c1
Sequence:CCGGGAGCAGACACTGGATGCTATTCTCGAGAATAGCATCCAGTGTCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022379    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_012163.1-1369s1c1
Sequence:CCGGCTGTGCTGTAAATCCTAAGATCTCGAGATCTTAGGATTTACAGCACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022381    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_012163.1-537s1c1
Sequence:CCGGGATGCCAGTTTAGCCAAGGTGCTCGAGCACCTTGGCTAAACTGGCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012163.1-919s1c1
Sequence:CCGGCTGACCTGACCCTAACACTCTCTCGAGAGAGTGTTAGGGTCAGGTCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012163.1-601s1c1
Sequence:CCGGCAGAACTCACAGACAACGGCTCTCGAGAGCCGTTGTCTGTGAGTTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177449
LRRC29 MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat containing 29
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000216466    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177449.3-1313s1c1
Sequence:CCGGGAGCAAACTCTGGATACAATTCTCGAGAATTGTATCCAGAGTTTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201167    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177449.2-32s1c1
Sequence:CCGGGCTCACATATATCCTGAGCTTCTCGAGAAGCTCAGGATATATGTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200973    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177449.2-465s1c1
Sequence:CCGGCGGGCATTAAGGTATGGAAATCTCGAGATTTCCATACCTTAATGCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192383    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177449.2-685s1c1
Sequence:CCGGCCAGAGGTTCTGAGTTCAATTCTCGAGAATTGAACTCAGAACCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177449.2-132s1c1
Sequence:CCGGGTAAGACCTCACTTGGTCCATCTCGAGATGGACCAAGTGAGGTCTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191012    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177449.2-1431s1c1
Sequence:CCGGCGTTCATCATTGGTTACTTAACTCGAGTTAAGTAACCAATGATGAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177449.2-268s1c1
Sequence:CCGGCACAGGTGAATAGAACATCATCTCGAGATGATGTTCTATTCACCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177449
LRRC29 MISSION shRNA shRNA Plasmid DNA
leucine rich repeat containing 29
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000216466    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177449.3-1313s1c1
Sequence:CCGGGAGCAAACTCTGGATACAATTCTCGAGAATTGTATCCAGAGTTTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201167    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177449.2-32s1c1
Sequence:CCGGGCTCACATATATCCTGAGCTTCTCGAGAAGCTCAGGATATATGTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200973    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177449.2-465s1c1
Sequence:CCGGCGGGCATTAAGGTATGGAAATCTCGAGATTTCCATACCTTAATGCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192383    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177449.2-685s1c1
Sequence:CCGGCCAGAGGTTCTGAGTTCAATTCTCGAGAATTGAACTCAGAACCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177449.2-132s1c1
Sequence:CCGGGTAAGACCTCACTTGGTCCATCTCGAGATGGACCAAGTGAGGTCTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191012    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177449.2-1431s1c1
Sequence:CCGGCGTTCATCATTGGTTACTTAACTCGAGTTAAGTAACCAATGATGAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177449.2-268s1c1
Sequence:CCGGCACAGGTGAATAGAACATCATCTCGAGATGATGTTCTATTCACCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177449
LRRC29 MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat containing 29
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000216466    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177449.3-1313s1c1
Sequence:CCGGGAGCAAACTCTGGATACAATTCTCGAGAATTGTATCCAGAGTTTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201167    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177449.2-32s1c1
Sequence:CCGGGCTCACATATATCCTGAGCTTCTCGAGAAGCTCAGGATATATGTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200973    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177449.2-465s1c1
Sequence:CCGGCGGGCATTAAGGTATGGAAATCTCGAGATTTCCATACCTTAATGCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192383    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177449.2-685s1c1
Sequence:CCGGCCAGAGGTTCTGAGTTCAATTCTCGAGAATTGAACTCAGAACCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177449.2-132s1c1
Sequence:CCGGGTAAGACCTCACTTGGTCCATCTCGAGATGGACCAAGTGAGGTCTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191012    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177449.2-1431s1c1
Sequence:CCGGCGTTCATCATTGGTTACTTAACTCGAGTTAAGTAACCAATGATGAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177449.2-268s1c1
Sequence:CCGGCACAGGTGAATAGAACATCATCTCGAGATGATGTTCTATTCACCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks