EMAIL THIS PAGE TO A FRIEND

LRRC37B

leucine rich repeat containing 37B

Species: Human LRRC37B(114659)
UniProtKB ID: Q96QE4, Q5YKG6
Gene ID:
35 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_052888 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_052888 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_052888 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU105751 MISSION® esiRNA esiRNA human LRRC37B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_052888 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_052888 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00039765 predicted 942
2 SASI_Hs01_00039769 predicted 2235
3 SASI_Hs01_00039770 predicted 674
4 SASI_Hs01_00039771 predicted 1487
5 SASI_Hs01_00039772 predicted 2224
6 SASI_Hs01_00039773 predicted 469
7 SASI_Hs01_00039774 predicted 1484
8 SASI_Hs02_00361600 predicted 1782
9 SASI_Hs02_00361601 predicted 340
10 SASI_Hs02_00361602 predicted 364
11 SASI_Hs01_00039766 predicted 2685
12 SASI_Hs01_00039767 predicted 2750
13 SASI_Hs01_00039768 predicted 2597
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_052888
VALIDATED
LRRC37B MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat containing 37B
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000165790    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052888.1-1289s1c1
Sequence:CCGGCAGAGGTTAAACCGTCTCCAACTCGAGTTGGAGACGGTTTAACCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163762    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052888.1-1579s1c1
Sequence:CCGGGATGAGACTCTGTCATGTGTTCTCGAGAACACATGACAGAGTCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161279    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_052888.1-2643s1c1
Sequence:CCGGGAATGAACAGAAAGAGCAGAACTCGAGTTCTGCTCTTTCTGTTCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159683    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052888.1-2722s1c1
Sequence:CCGGGCAATATCTGTGACTGTAATACTCGAGTATTACAGTCACAGATATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160050    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052888.1-1968s1c1
Sequence:CCGGCAACTTAATTCTCAATCGCAACTCGAGTTGCGATTGAGAATTAAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162629    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052888.1-2062s1c1
Sequence:CCGGCACATCACACTTACAACACTTCTCGAGAAGTGTTGTAAGTGTGATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162024    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052888.1-1466s1c1
Sequence:CCGGGTCCACCTACAAAGTTAGAATCTCGAGATTCTAACTTTGTAGGTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163741    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052888.1-343s1c1
Sequence:CCGGGCTGCACATCAGGACTTAAATCTCGAGATTTAAGTCCTGATGTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052888.2-55s21c1
Sequence:CCGGGGCAACTATTGTCTTTACTAGCTCGAGCTAGTAAAGACAATAGTTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422405    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052888.2-419s21c1
Sequence:CCGGGCTTCTCAACCGGGATCAGAACTCGAGTTCTGATCCCGGTTGAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_052888
VALIDATED
LRRC37B MISSION shRNA shRNA Plasmid DNA
leucine rich repeat containing 37B
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000165790    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052888.1-1289s1c1
Sequence:CCGGCAGAGGTTAAACCGTCTCCAACTCGAGTTGGAGACGGTTTAACCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163762    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052888.1-1579s1c1
Sequence:CCGGGATGAGACTCTGTCATGTGTTCTCGAGAACACATGACAGAGTCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161279    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_052888.1-2643s1c1
Sequence:CCGGGAATGAACAGAAAGAGCAGAACTCGAGTTCTGCTCTTTCTGTTCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159683    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052888.1-2722s1c1
Sequence:CCGGGCAATATCTGTGACTGTAATACTCGAGTATTACAGTCACAGATATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160050    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052888.1-1968s1c1
Sequence:CCGGCAACTTAATTCTCAATCGCAACTCGAGTTGCGATTGAGAATTAAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162629    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052888.1-2062s1c1
Sequence:CCGGCACATCACACTTACAACACTTCTCGAGAAGTGTTGTAAGTGTGATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162024    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052888.1-1466s1c1
Sequence:CCGGGTCCACCTACAAAGTTAGAATCTCGAGATTCTAACTTTGTAGGTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163741    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052888.1-343s1c1
Sequence:CCGGGCTGCACATCAGGACTTAAATCTCGAGATTTAAGTCCTGATGTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052888.2-55s21c1
Sequence:CCGGGGCAACTATTGTCTTTACTAGCTCGAGCTAGTAAAGACAATAGTTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422405    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052888.2-419s21c1
Sequence:CCGGGCTTCTCAACCGGGATCAGAACTCGAGTTCTGATCCCGGTTGAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_052888
VALIDATED
LRRC37B MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat containing 37B
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000165790    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052888.1-1289s1c1
Sequence:CCGGCAGAGGTTAAACCGTCTCCAACTCGAGTTGGAGACGGTTTAACCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163762    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052888.1-1579s1c1
Sequence:CCGGGATGAGACTCTGTCATGTGTTCTCGAGAACACATGACAGAGTCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161279    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_052888.1-2643s1c1
Sequence:CCGGGAATGAACAGAAAGAGCAGAACTCGAGTTCTGCTCTTTCTGTTCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159683    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052888.1-2722s1c1
Sequence:CCGGGCAATATCTGTGACTGTAATACTCGAGTATTACAGTCACAGATATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160050    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052888.1-1968s1c1
Sequence:CCGGCAACTTAATTCTCAATCGCAACTCGAGTTGCGATTGAGAATTAAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162629    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052888.1-2062s1c1
Sequence:CCGGCACATCACACTTACAACACTTCTCGAGAAGTGTTGTAAGTGTGATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162024    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052888.1-1466s1c1
Sequence:CCGGGTCCACCTACAAAGTTAGAATCTCGAGATTCTAACTTTGTAGGTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163741    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052888.1-343s1c1
Sequence:CCGGGCTGCACATCAGGACTTAAATCTCGAGATTTAAGTCCTGATGTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052888.2-55s21c1
Sequence:CCGGGGCAACTATTGTCTTTACTAGCTCGAGCTAGTAAAGACAATAGTTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422405    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052888.2-419s21c1
Sequence:CCGGGCTTCTCAACCGGGATCAGAACTCGAGTTCTGATCCCGGTTGAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks