EMAIL THIS PAGE TO A FRIEND

LRRC3

leucine rich repeat containing 3

Synonyms: C21orf102
UniProtKB ID: Q9BY71, Q0VDJ2
Gene ID:
Mouse(237387) leucine rich repeat containing 3
Rat(246773) leucine rich repeat containing 3
Zebrafish(100001372) leucine rich repeat containing 3
domestic cat(101082934) leucine rich repeat containing 3
cow(506054) leucine rich repeat containing 3
dog(487800) leucine rich repeat containing 3
domestic guinea pig(100720589) leucine rich repeat containing 3
naked mole-rat(101722737) leucine rich repeat containing 3
sheep(101108273) leucine rich repeat containing 3
48 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145152 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145152 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145152 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_030891 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030891 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030891 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_030891 Rosetta Predictions human pricing
NM_145679 Rosetta Predictions rat pricing
NM_145152 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030891 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00231640 predicted 805
2 SASI_Hs01_00231641 predicted 688
3 SASI_Hs01_00231642 predicted 700
4 SASI_Hs01_00231643 predicted 481
5 SASI_Hs01_00231645 predicted 1526
6 SASI_Hs01_00231646 predicted 1396
7 SASI_Hs01_00231647 predicted 1419
8 SASI_Hs01_00231648 predicted 1445
9 SASI_Hs01_00231649 predicted 477
10 SASI_Hs02_00358420 predicted 1549
11 SASI_Hs01_00231644 predicted 345
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145679 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00046508 predicted 662
2 SASI_Rn01_00046509 predicted 682
3 SASI_Rn01_00046510 predicted 336
4 SASI_Rn01_00046511 predicted 411
5 SASI_Rn01_00046512 predicted 492
6 SASI_Rn01_00046513 predicted 673
7 SASI_Rn01_00046514 predicted 543
8 SASI_Rn01_00046515 predicted 307
9 SASI_Rn02_00268733 predicted 676
10 SASI_Rn01_00046516 predicted 367
11 SASI_Rn01_00046517 predicted 440
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145152 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00106552 predicted 911
2 SASI_Mm01_00106553 predicted 1531
3 SASI_Mm01_00106554 predicted 1481
4 SASI_Mm01_00106555 predicted 811
5 SASI_Mm02_00340576 predicted 568
6 SASI_Mm01_00106556 predicted 966
7 SASI_Mm01_00106557 predicted 415
8 SASI_Mm01_00106558 predicted 925
9 SASI_Mm01_00106559 predicted 630
10 SASI_Mm01_00106561 predicted 480
11 SASI_Mm01_00106560 predicted 1424
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145152
LRRC3 MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat containing 3
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000194640    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145152.2-446s1c1
Sequence:CCGGGCTTCTGAAACTAGACGCCAACTCGAGTTGGCGTCTAGTTTCAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145152.2-899s1c1
Sequence:CCGGGATTGCCTACGTAGTGTACTACTCGAGTAGTACACTACGTAGGCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174644    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145152.2-1134s1c1
Sequence:CCGGGCACTTTCATAGTTGGTATTTCTCGAGAAATACCAACTATGAAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145152.2-608s1c1
Sequence:CCGGCCACAATCGCATCCGAAGAATCTCGAGATTCTTCGGATGCGATTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145152.2-903s1c1
Sequence:CCGGGCCTACGTAGTGTACTACGTACTCGAGTACGTAGTACACTACGTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215911    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145152.4-1230s1c1
Sequence:CCGGCATCTTAATGGGTAGGTAAATCTCGAGATTTACCTACCCATTAAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145152
LRRC3 MISSION shRNA shRNA Plasmid DNA
leucine rich repeat containing 3
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000194640    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145152.2-446s1c1
Sequence:CCGGGCTTCTGAAACTAGACGCCAACTCGAGTTGGCGTCTAGTTTCAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145152.2-899s1c1
Sequence:CCGGGATTGCCTACGTAGTGTACTACTCGAGTAGTACACTACGTAGGCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174644    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145152.2-1134s1c1
Sequence:CCGGGCACTTTCATAGTTGGTATTTCTCGAGAAATACCAACTATGAAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145152.2-608s1c1
Sequence:CCGGCCACAATCGCATCCGAAGAATCTCGAGATTCTTCGGATGCGATTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145152.2-903s1c1
Sequence:CCGGGCCTACGTAGTGTACTACGTACTCGAGTACGTAGTACACTACGTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215911    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145152.4-1230s1c1
Sequence:CCGGCATCTTAATGGGTAGGTAAATCTCGAGATTTACCTACCCATTAAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145152
LRRC3 MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat containing 3
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000194640    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145152.2-446s1c1
Sequence:CCGGGCTTCTGAAACTAGACGCCAACTCGAGTTGGCGTCTAGTTTCAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145152.2-899s1c1
Sequence:CCGGGATTGCCTACGTAGTGTACTACTCGAGTAGTACACTACGTAGGCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174644    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145152.2-1134s1c1
Sequence:CCGGGCACTTTCATAGTTGGTATTTCTCGAGAAATACCAACTATGAAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145152.2-608s1c1
Sequence:CCGGCCACAATCGCATCCGAAGAATCTCGAGATTCTTCGGATGCGATTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145152.2-903s1c1
Sequence:CCGGGCCTACGTAGTGTACTACGTACTCGAGTACGTAGTACACTACGTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215911    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145152.4-1230s1c1
Sequence:CCGGCATCTTAATGGGTAGGTAAATCTCGAGATTTACCTACCCATTAAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030891
LRRC3 MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat containing 3
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166831    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030891.3-1283s1c1
Sequence:CCGGCGTGACGATACCATCAGGAAACTCGAGTTTCCTGATGGTATCGTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164995    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030891.3-347s1c1
Sequence:CCGGGTCTTGTCTCTTCCTCCTCTTCTCGAGAAGAGGAGGAAGAGACAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158662    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030891.3-2267s1c1
Sequence:CCGGCAGAGATAATTTAGTGCTCAACTCGAGTTGAGCACTAAATTATCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159049    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030891.3-2180s1c1
Sequence:CCGGGATTGATGTTTCAAGGCCAATCTCGAGATTGGCCTTGAAACATCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160610    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030891.3-2325s1c1
Sequence:CCGGCTCCACCTATATGATAGTAATCTCGAGATTACTATCATATAGGTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160609    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030891.3-2296s1c1
Sequence:CCGGCCTTACTTCACATTCAGGTTACTCGAGTAACCTGAATGTGAAGTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160667    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030891.3-2324s1c1
Sequence:CCGGCCTCCACCTATATGATAGTAACTCGAGTTACTATCATATAGGTGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161592    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030891.3-2256s1c1
Sequence:CCGGGCCAGGAATCTCAGAGATAATCTCGAGATTATCTCTGAGATTCCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165013    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030891.3-1635s1c1
Sequence:CCGGGAGAGCTAAGTGGGATGTGTACTCGAGTACACATCCCACTTAGCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166256    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030891.3-349s1c1
Sequence:CCGGCTTGTCTCTTCCTCCTCTTCTCTCGAGAGAAGAGGAGGAAGAGACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165456    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030891.3-500s1c1
Sequence:CCGGGAAGCTCGATGCCAACAAGATCTCGAGATCTTGTTGGCATCGAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030891
LRRC3 MISSION shRNA shRNA Plasmid DNA
leucine rich repeat containing 3
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166831    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030891.3-1283s1c1
Sequence:CCGGCGTGACGATACCATCAGGAAACTCGAGTTTCCTGATGGTATCGTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164995    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030891.3-347s1c1
Sequence:CCGGGTCTTGTCTCTTCCTCCTCTTCTCGAGAAGAGGAGGAAGAGACAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158662    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030891.3-2267s1c1
Sequence:CCGGCAGAGATAATTTAGTGCTCAACTCGAGTTGAGCACTAAATTATCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159049    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030891.3-2180s1c1
Sequence:CCGGGATTGATGTTTCAAGGCCAATCTCGAGATTGGCCTTGAAACATCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160610    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030891.3-2325s1c1
Sequence:CCGGCTCCACCTATATGATAGTAATCTCGAGATTACTATCATATAGGTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160609    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030891.3-2296s1c1
Sequence:CCGGCCTTACTTCACATTCAGGTTACTCGAGTAACCTGAATGTGAAGTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160667    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030891.3-2324s1c1
Sequence:CCGGCCTCCACCTATATGATAGTAACTCGAGTTACTATCATATAGGTGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161592    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030891.3-2256s1c1
Sequence:CCGGGCCAGGAATCTCAGAGATAATCTCGAGATTATCTCTGAGATTCCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165013    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030891.3-1635s1c1
Sequence:CCGGGAGAGCTAAGTGGGATGTGTACTCGAGTACACATCCCACTTAGCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166256    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030891.3-349s1c1
Sequence:CCGGCTTGTCTCTTCCTCCTCTTCTCTCGAGAGAAGAGGAGGAAGAGACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165456    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030891.3-500s1c1
Sequence:CCGGGAAGCTCGATGCCAACAAGATCTCGAGATCTTGTTGGCATCGAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030891
LRRC3 MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat containing 3
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166831    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030891.3-1283s1c1
Sequence:CCGGCGTGACGATACCATCAGGAAACTCGAGTTTCCTGATGGTATCGTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164995    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030891.3-347s1c1
Sequence:CCGGGTCTTGTCTCTTCCTCCTCTTCTCGAGAAGAGGAGGAAGAGACAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158662    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030891.3-2267s1c1
Sequence:CCGGCAGAGATAATTTAGTGCTCAACTCGAGTTGAGCACTAAATTATCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159049    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030891.3-2180s1c1
Sequence:CCGGGATTGATGTTTCAAGGCCAATCTCGAGATTGGCCTTGAAACATCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160610    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030891.3-2325s1c1
Sequence:CCGGCTCCACCTATATGATAGTAATCTCGAGATTACTATCATATAGGTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160609    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030891.3-2296s1c1
Sequence:CCGGCCTTACTTCACATTCAGGTTACTCGAGTAACCTGAATGTGAAGTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160667    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030891.3-2324s1c1
Sequence:CCGGCCTCCACCTATATGATAGTAACTCGAGTTACTATCATATAGGTGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161592    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030891.3-2256s1c1
Sequence:CCGGGCCAGGAATCTCAGAGATAATCTCGAGATTATCTCTGAGATTCCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165013    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030891.3-1635s1c1
Sequence:CCGGGAGAGCTAAGTGGGATGTGTACTCGAGTACACATCCCACTTAGCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166256    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030891.3-349s1c1
Sequence:CCGGCTTGTCTCTTCCTCCTCTTCTCTCGAGAGAAGAGGAGGAAGAGACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165456    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030891.3-500s1c1
Sequence:CCGGGAAGCTCGATGCCAACAAGATCTCGAGATCTTGTTGGCATCGAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks