EMAIL THIS PAGE TO A FRIEND

LRRC46

leucine rich repeat containing 46

UniProtKB ID: Q96FV0
Gene ID:
Mouse(69297) leucine rich repeat containing 46
Rat(287653) leucine rich repeat containing 46
domestic guinea pig(100721594) leucine rich repeat containing 46
naked mole-rat(101699398) leucine rich repeat containing 46
sheep(101117945) leucine rich repeat containing 46
chicken(776636) leucine rich repeat containing 46
cow(780880) leucine rich repeat containing 46
domestic cat(101097359) leucine rich repeat containing 46
dog(480539) leucine rich repeat containing 46
46 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033413 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033413 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033413 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027026 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027026 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027026 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU026481 MISSION® esiRNA esiRNA human LRRC46 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033413 Rosetta Predictions human pricing
NM_001004201 Rosetta Predictions rat pricing
NM_027026 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033413 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00230482 predicted 293
2 SASI_Hs01_00230483 predicted 477
3 SASI_Hs01_00230484 predicted 329
4 SASI_Hs01_00230485 predicted 621
5 SASI_Hs01_00230486 predicted 789
6 SASI_Hs01_00230487 predicted 310
7 SASI_Hs01_00230488 predicted 307
8 SASI_Hs01_00230489 predicted 715
9 SASI_Hs01_00230490 predicted 541
10 SASI_Hs01_00230491 predicted 357
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004201 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00095251 predicted 428
2 SASI_Rn01_00095254 predicted 281
3 SASI_Rn01_00095255 predicted 440
4 SASI_Rn02_00198168 predicted 286
5 SASI_Rn01_00095257 predicted 269
6 SASI_Rn01_00095258 predicted 656
7 SASI_Rn02_00198169 predicted 418
8 SASI_Rn02_00198170 predicted 419
9 SASI_Rn02_00198171 predicted 504
10 SASI_Rn01_00095260 predicted 811
11 SASI_Rn01_00095252 predicted 246
12 SASI_Rn01_00095253 predicted 785
13 SASI_Rn01_00095256 predicted 312
14 SASI_Rn01_00095259 predicted 577
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027026 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00117914 predicted 569
2 SASI_Mm01_00117915 predicted 660
3 SASI_Mm01_00117916 predicted 437
4 SASI_Mm01_00117917 predicted 314
5 SASI_Mm01_00117918 predicted 801
6 SASI_Mm01_00117919 predicted 937
7 SASI_Mm01_00117920 predicted 327
8 SASI_Mm01_00117921 predicted 384
9 SASI_Mm01_00117922 predicted 1062
10 SASI_Mm01_00117923 predicted 721
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033413
LRRC46 MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat containing 46
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000359616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033413.2-466s21c1
Sequence:CCGGTCTCTATCTGCAAGGGAATAACTCGAGTTATTCCCTTGCAGATAGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033413.2-423s21c1
Sequence:CCGGTTACTACTATCAGGAACTTAGCTCGAGCTAAGTTCCTGATAGTAGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033413.2-1200s21c1
Sequence:CCGGCGGCCAAGAGAAGCAAGAAATCTCGAGATTTCTTGCTTCTCTTGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033413.2-308s21c1
Sequence:CCGGACTGAAGCCCTTATCACTAAGCTCGAGCTTAGTGATAAGGGCTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033413.2-602s1c1
Sequence:CCGGGACCTTTCTGAGAACCTGATACTCGAGTATCAGGTTCTCAGAAAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033413.2-616s1c1
Sequence:CCGGCCTGATAGAAACATTGAAGCTCTCGAGAGCTTCAATGTTTCTATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033413.2-451s1c1
Sequence:CCGGCCAGAATCTTCACAGTCTCTACTCGAGTAGAGACTGTGAAGATTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033413.2-356s1c1
Sequence:CCGGGAACTGTCAGAGAAGATGTTTCTCGAGAAACATCTTCTCTGACAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033413.2-476s1c1
Sequence:CCGGCAAGGGAATAAGATCCAGCAACTCGAGTTGCTGGATCTTATTCCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033413
LRRC46 MISSION shRNA shRNA Plasmid DNA
leucine rich repeat containing 46
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000359616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033413.2-466s21c1
Sequence:CCGGTCTCTATCTGCAAGGGAATAACTCGAGTTATTCCCTTGCAGATAGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033413.2-423s21c1
Sequence:CCGGTTACTACTATCAGGAACTTAGCTCGAGCTAAGTTCCTGATAGTAGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033413.2-1200s21c1
Sequence:CCGGCGGCCAAGAGAAGCAAGAAATCTCGAGATTTCTTGCTTCTCTTGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033413.2-308s21c1
Sequence:CCGGACTGAAGCCCTTATCACTAAGCTCGAGCTTAGTGATAAGGGCTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033413.2-602s1c1
Sequence:CCGGGACCTTTCTGAGAACCTGATACTCGAGTATCAGGTTCTCAGAAAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033413.2-616s1c1
Sequence:CCGGCCTGATAGAAACATTGAAGCTCTCGAGAGCTTCAATGTTTCTATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033413.2-451s1c1
Sequence:CCGGCCAGAATCTTCACAGTCTCTACTCGAGTAGAGACTGTGAAGATTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033413.2-356s1c1
Sequence:CCGGGAACTGTCAGAGAAGATGTTTCTCGAGAAACATCTTCTCTGACAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033413.2-476s1c1
Sequence:CCGGCAAGGGAATAAGATCCAGCAACTCGAGTTGCTGGATCTTATTCCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033413
LRRC46 MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat containing 46
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000359616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033413.2-466s21c1
Sequence:CCGGTCTCTATCTGCAAGGGAATAACTCGAGTTATTCCCTTGCAGATAGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033413.2-423s21c1
Sequence:CCGGTTACTACTATCAGGAACTTAGCTCGAGCTAAGTTCCTGATAGTAGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033413.2-1200s21c1
Sequence:CCGGCGGCCAAGAGAAGCAAGAAATCTCGAGATTTCTTGCTTCTCTTGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033413.2-308s21c1
Sequence:CCGGACTGAAGCCCTTATCACTAAGCTCGAGCTTAGTGATAAGGGCTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033413.2-602s1c1
Sequence:CCGGGACCTTTCTGAGAACCTGATACTCGAGTATCAGGTTCTCAGAAAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033413.2-616s1c1
Sequence:CCGGCCTGATAGAAACATTGAAGCTCTCGAGAGCTTCAATGTTTCTATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033413.2-451s1c1
Sequence:CCGGCCAGAATCTTCACAGTCTCTACTCGAGTAGAGACTGTGAAGATTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033413.2-356s1c1
Sequence:CCGGGAACTGTCAGAGAAGATGTTTCTCGAGAAACATCTTCTCTGACAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033413.2-476s1c1
Sequence:CCGGCAAGGGAATAAGATCCAGCAACTCGAGTTGCTGGATCTTATTCCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027026
LRRC46 MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat containing 46
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000088193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027026.2-322s1c1
Sequence:CCGGCCACATTACTGAAGCCCTTATCTCGAGATAAGGGCTTCAGTAATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027026.2-442s1c1
Sequence:CCGGGATTACTTGTATCGGGAATTTCTCGAGAAATTCCCGATACAAGTAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027026.2-556s1c1
Sequence:CCGGGTCTTTGGCAAGAAACCAAATCTCGAGATTTGGTTTCTTGCCAAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027026.2-321s1c1
Sequence:CCGGTCCACATTACTGAAGCCCTTACTCGAGTAAGGGCTTCAGTAATGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027026.2-472s1c1
Sequence:CCGGCCGGAATATTCACAGCCTCTACTCGAGTAGAGGCTGTGAATATTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027026
LRRC46 MISSION shRNA shRNA Plasmid DNA
leucine rich repeat containing 46
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000088193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027026.2-322s1c1
Sequence:CCGGCCACATTACTGAAGCCCTTATCTCGAGATAAGGGCTTCAGTAATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027026.2-442s1c1
Sequence:CCGGGATTACTTGTATCGGGAATTTCTCGAGAAATTCCCGATACAAGTAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027026.2-556s1c1
Sequence:CCGGGTCTTTGGCAAGAAACCAAATCTCGAGATTTGGTTTCTTGCCAAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027026.2-321s1c1
Sequence:CCGGTCCACATTACTGAAGCCCTTACTCGAGTAAGGGCTTCAGTAATGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027026.2-472s1c1
Sequence:CCGGCCGGAATATTCACAGCCTCTACTCGAGTAGAGGCTGTGAATATTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027026
LRRC46 MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat containing 46
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000088193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027026.2-322s1c1
Sequence:CCGGCCACATTACTGAAGCCCTTATCTCGAGATAAGGGCTTCAGTAATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027026.2-442s1c1
Sequence:CCGGGATTACTTGTATCGGGAATTTCTCGAGAAATTCCCGATACAAGTAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027026.2-556s1c1
Sequence:CCGGGTCTTTGGCAAGAAACCAAATCTCGAGATTTGGTTTCTTGCCAAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027026.2-321s1c1
Sequence:CCGGTCCACATTACTGAAGCCCTTACTCGAGTAAGGGCTTCAGTAATGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027026.2-472s1c1
Sequence:CCGGCCGGAATATTCACAGCCTCTACTCGAGTAGAGGCTGTGAATATTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks