EMAIL THIS PAGE TO A FRIEND

LRRC52

leucine rich repeat containing 52

UniProtKB ID: Q8N7C0, A2RUN7, Q5T9K5
Gene ID:
Mouse(240899) leucine rich repeat containing 52
Rat(289199) leucine rich repeat containing 52
sheep(101112100) leucine rich repeat containing 52
naked mole-rat(101716474) leucine rich repeat containing 52
domestic guinea pig(100730077) leucine rich repeat containing 52
chicken(770767) leucine rich repeat containing 52
dog(488671) leucine rich repeat containing 52
domestic cat(101081020) leucine rich repeat containing 52
cow(536513) leucine rich repeat containing 52
53 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001013382 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001013382 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001013382 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001005214 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001005214 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001005214 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001005214 Rosetta Predictions human pricing
NM_001077434 Rosetta Predictions rat pricing
NM_001013382 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005214 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00144047 predicted 813
2 SASI_Hs01_00144048 predicted 863
3 SASI_Hs01_00144049 predicted 997
4 SASI_Hs01_00144050 predicted 870
5 SASI_Hs01_00144051 predicted 867
6 SASI_Hs02_00304786 predicted 1028
7 SASI_Hs01_00144052 predicted 906
8 SASI_Hs01_00144053 predicted 1001
9 SASI_Hs01_00144054 predicted 945
10 SASI_Hs01_00144055 predicted 843
11 SASI_Hs01_00144056 predicted 1000
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077434 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00207542 predicted 623
2 SASI_Rn02_00207543 predicted 445
3 SASI_Rn02_00207544 predicted 418
4 SASI_Rn02_00207545 predicted 458
5 SASI_Rn02_00207546 predicted 462
6 SASI_Rn02_00207547 predicted 928
7 SASI_Rn02_00207548 predicted 817
8 SASI_Rn02_00207549 predicted 624
9 SASI_Rn02_00207550 predicted 478
10 SASI_Rn02_00207551 predicted 1002
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013382 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00051947 predicted 547
2 SASI_Mm02_00287210 predicted 477
3 SASI_Mm01_00051948 predicted 636
4 SASI_Mm01_00051950 predicted 449
5 SASI_Mm01_00051951 predicted 589
6 SASI_Mm01_00051952 predicted 203
7 SASI_Mm01_00051953 predicted 337
8 SASI_Mm01_00051954 predicted 328
9 SASI_Mm01_00051955 predicted 461
10 SASI_Mm01_00051956 predicted 759
11 SASI_Mm01_00051949 predicted 867
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001013382
LRRC52 MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat containing 52
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000253450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013382.2-199s21c1
Sequence:CCGGACGGAATACCCAGCTGATATTCTCGAGAATATCAGCTGGGTATTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013382.2-222s21c1
Sequence:CCGGTCTGAACACCCGGAGACTATACTCGAGTATAGTCTCCGGGTGTTCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013382.2-646s21c1
Sequence:CCGGGACTTCACCATCCACTTATTACTCGAGTAATAAGTGGATGGTGAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013382.2-332s21c1
Sequence:CCGGTTCGAGAGGTGATGGATTATACTCGAGTATAATCCATCACCTCTCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217767    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013382.2-172s1c1
Sequence:CCGGGAAGTAGCCTGCATAGATTTGCTCGAGCAAATCTATGCAGGCTACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013382.2-550s21c1
Sequence:CCGGTTGCACATCATCGACCATAATCTCGAGATTATGGTCGATGATGTGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173947    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013382.1-936s1c1
Sequence:CCGGGAGTAGATTCGCCAACCAGATCTCGAGATCTGGTTGGCGAATCTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193429    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013382.1-646s1c1
Sequence:CCGGGACTTCACCATCCACTTATTACTCGAGTAATAAGTGGATGGTGAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001013382
LRRC52 MISSION shRNA shRNA Plasmid DNA
leucine rich repeat containing 52
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000253450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013382.2-199s21c1
Sequence:CCGGACGGAATACCCAGCTGATATTCTCGAGAATATCAGCTGGGTATTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013382.2-222s21c1
Sequence:CCGGTCTGAACACCCGGAGACTATACTCGAGTATAGTCTCCGGGTGTTCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013382.2-646s21c1
Sequence:CCGGGACTTCACCATCCACTTATTACTCGAGTAATAAGTGGATGGTGAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013382.2-332s21c1
Sequence:CCGGTTCGAGAGGTGATGGATTATACTCGAGTATAATCCATCACCTCTCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217767    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013382.2-172s1c1
Sequence:CCGGGAAGTAGCCTGCATAGATTTGCTCGAGCAAATCTATGCAGGCTACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013382.2-550s21c1
Sequence:CCGGTTGCACATCATCGACCATAATCTCGAGATTATGGTCGATGATGTGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173947    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013382.1-936s1c1
Sequence:CCGGGAGTAGATTCGCCAACCAGATCTCGAGATCTGGTTGGCGAATCTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193429    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013382.1-646s1c1
Sequence:CCGGGACTTCACCATCCACTTATTACTCGAGTAATAAGTGGATGGTGAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001013382
LRRC52 MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat containing 52
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000253450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013382.2-199s21c1
Sequence:CCGGACGGAATACCCAGCTGATATTCTCGAGAATATCAGCTGGGTATTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013382.2-222s21c1
Sequence:CCGGTCTGAACACCCGGAGACTATACTCGAGTATAGTCTCCGGGTGTTCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013382.2-646s21c1
Sequence:CCGGGACTTCACCATCCACTTATTACTCGAGTAATAAGTGGATGGTGAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013382.2-332s21c1
Sequence:CCGGTTCGAGAGGTGATGGATTATACTCGAGTATAATCCATCACCTCTCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217767    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013382.2-172s1c1
Sequence:CCGGGAAGTAGCCTGCATAGATTTGCTCGAGCAAATCTATGCAGGCTACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013382.2-550s21c1
Sequence:CCGGTTGCACATCATCGACCATAATCTCGAGATTATGGTCGATGATGTGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173947    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013382.1-936s1c1
Sequence:CCGGGAGTAGATTCGCCAACCAGATCTCGAGATCTGGTTGGCGAATCTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193429    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013382.1-646s1c1
Sequence:CCGGGACTTCACCATCCACTTATTACTCGAGTAATAAGTGGATGGTGAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001005214
LRRC52 MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat containing 52
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005214.1-1006s1c1
Sequence:CCGGGCACCTAGACCACAAAGACTACTCGAGTAGTCTTTGTGGTCTAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005214.1-676s1c1
Sequence:CCGGGCAGCTGAACATTGCCAACAACTCGAGTTGTTGGCAATGTTCAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005214.1-526s1c1
Sequence:CCGGCCTTGTTTATTTGGACTGTCACTCGAGTGACAGTCCAAATAAACAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136262    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005214.1-590s1c1
Sequence:CCGGGTCTTCAAACTCATCTACCTTCTCGAGAAGGTAGATGAGTTTGAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005214.1-475s1c1
Sequence:CCGGCGAGAACAGAATCACTAGTTTCTCGAGAAACTAGTGATTCTGTTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005214.1-847s1c1
Sequence:CCGGCTGGAAGTGCAACTGCTCTTTCTCGAGAAAGAGCAGTTGCACTTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137868    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005214.1-856s1c1
Sequence:CCGGCAACTGCTCTTTCCTGGACTTCTCGAGAAGTCCAGGAAAGAGCAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001005214
LRRC52 MISSION shRNA shRNA Plasmid DNA
leucine rich repeat containing 52
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005214.1-1006s1c1
Sequence:CCGGGCACCTAGACCACAAAGACTACTCGAGTAGTCTTTGTGGTCTAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005214.1-676s1c1
Sequence:CCGGGCAGCTGAACATTGCCAACAACTCGAGTTGTTGGCAATGTTCAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005214.1-526s1c1
Sequence:CCGGCCTTGTTTATTTGGACTGTCACTCGAGTGACAGTCCAAATAAACAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136262    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005214.1-590s1c1
Sequence:CCGGGTCTTCAAACTCATCTACCTTCTCGAGAAGGTAGATGAGTTTGAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005214.1-475s1c1
Sequence:CCGGCGAGAACAGAATCACTAGTTTCTCGAGAAACTAGTGATTCTGTTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005214.1-847s1c1
Sequence:CCGGCTGGAAGTGCAACTGCTCTTTCTCGAGAAAGAGCAGTTGCACTTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137868    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005214.1-856s1c1
Sequence:CCGGCAACTGCTCTTTCCTGGACTTCTCGAGAAGTCCAGGAAAGAGCAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001005214
LRRC52 MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat containing 52
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005214.1-1006s1c1
Sequence:CCGGGCACCTAGACCACAAAGACTACTCGAGTAGTCTTTGTGGTCTAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005214.1-676s1c1
Sequence:CCGGGCAGCTGAACATTGCCAACAACTCGAGTTGTTGGCAATGTTCAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005214.1-526s1c1
Sequence:CCGGCCTTGTTTATTTGGACTGTCACTCGAGTGACAGTCCAAATAAACAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136262    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005214.1-590s1c1
Sequence:CCGGGTCTTCAAACTCATCTACCTTCTCGAGAAGGTAGATGAGTTTGAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005214.1-475s1c1
Sequence:CCGGCGAGAACAGAATCACTAGTTTCTCGAGAAACTAGTGATTCTGTTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005214.1-847s1c1
Sequence:CCGGCTGGAAGTGCAACTGCTCTTTCTCGAGAAAGAGCAGTTGCACTTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137868    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005214.1-856s1c1
Sequence:CCGGCAACTGCTCTTTCCTGGACTTCTCGAGAAGTCCAGGAAAGAGCAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks