EMAIL THIS PAGE TO A FRIEND

LRRC8A

leucine rich repeat containing 8 family, member A

Synonyms: AGM5 LRRC8
UniProtKB ID: Q8IWT6, Q6UXM2, Q8NCI0, Q9P2B1
Gene ID:
Human(56262) Summary: This gene encodes a protein belonging to the leucine-rich repeat family of proteins, which are involved in diverse biological processes, including cell adhesion, cellular trafficking, and hormone-receptor interactions. This family member is a putative four-pass transmembrane protein that plays a role in B cell development. Defects in this gene cause autosomal dominant non-Bruton type agammaglobulinemia, an immunodeficiency disease resulting from defects in B cell maturation. Multiple alternatively spliced transcript variants, which encode the same protein, have been identified for this gene. [provided by RefSeq, Jul 2008]
Mouse(241296) leucine rich repeat containing 8A
Rat(311846) leucine rich repeat containing 8 family, member A
sheep(101117230) leucine rich repeat containing 8 family, member A
naked mole-rat(101716040) leucine rich repeat containing 8 family, member A
domestic guinea pig(100726291) leucine rich repeat containing 8 family, member A
Zebrafish(327642) leucine rich repeat containing 8 family, member A
domestic cat(101082860) leucine rich repeat containing 8 family, member A
cow(505605) leucine rich repeat containing 8 family, member A
Horse(100066843) leucine rich repeat containing 8 family, member A
dog(491309) leucine rich repeat containing 8 family, member A
chicken(417201) leucine rich repeat containing 8 family, member A
139 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177725 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177725 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177725 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_019594 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_019594 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_019594 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001127244 Rosetta Predictions human pricing
NM_001127245 Rosetta Predictions human pricing
NM_019594 Rosetta Predictions human pricing
NM_001024782 Rosetta Predictions rat pricing
NM_177725 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127244 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00329027 predicted 3318
2 SASI_Hs02_00329028 predicted 3280
3 SASI_Hs02_00329029 predicted 1325
4 SASI_Hs02_00329030 predicted 2457
5 SASI_Hs02_00329031 predicted 1288
6 SASI_Hs02_00329032 predicted 1306
7 SASI_Hs02_00329033 predicted 1577
8 SASI_Hs02_00329034 predicted 3187
9 SASI_Hs02_00329035 predicted 2051
10 SASI_Hs02_00329036 predicted 3196
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127245 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00329037 predicted 2944
2 SASI_Hs02_00329038 predicted 2908
3 SASI_Hs02_00329039 predicted 941
4 SASI_Hs02_00329040 predicted 2086
5 SASI_Hs02_00329041 predicted 916
6 SASI_Hs02_00329042 predicted 925
7 SASI_Hs02_00329043 predicted 1195
8 SASI_Hs02_00329044 predicted 2806
9 SASI_Hs02_00329045 predicted 1675
10 SASI_Hs02_00329046 predicted 2820
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019594 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00352789 predicted 3053
2 SASI_Hs02_00352790 predicted 3015
3 SASI_Hs01_00097279 predicted 1054
4 SASI_Hs01_00097280 predicted 2189
5 SASI_Hs01_00097282 predicted 1018
6 SASI_Hs01_00097284 predicted 1034
7 SASI_Hs01_00097285 predicted 1299
8 SASI_Hs02_00352791 predicted 2916
9 SASI_Hs02_00352792 predicted 1778
10 SASI_Hs02_00352793 predicted 2930
11 SASI_Hs01_00097278 predicted 2128
12 SASI_Hs01_00097281 predicted 2055
13 SASI_Hs01_00097283 predicted 284
14 SASI_Hs01_00097286 predicted 362
15 SASI_Hs01_00097287 predicted 1170
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024782 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00050456 predicted 2259
2 SASI_Rn01_00050457 predicted 2096
3 SASI_Rn01_00050458 predicted 328
4 SASI_Rn02_00202676 predicted 1479
5 SASI_Rn01_00050459 predicted 239
6 SASI_Rn01_00050460 predicted 1211
7 SASI_Rn01_00050461 predicted 946
8 SASI_Rn01_00050462 predicted 1447
9 SASI_Rn01_00050463 predicted 1789
10 SASI_Rn01_00050464 predicted 246
11 SASI_Rn01_00050465 predicted 331
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177725 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00177418 predicted 2093
2 SASI_Mm01_00177419 predicted 2021
3 SASI_Mm01_00177420 predicted 315
4 SASI_Mm01_00177421 predicted 920
5 SASI_Mm02_00348089 predicted 941
6 SASI_Mm01_00177422 predicted 1440
7 SASI_Mm01_00177423 predicted 230
8 SASI_Mm01_00177424 predicted 1094
9 SASI_Mm01_00177425 predicted 2357
10 SASI_Mm01_00177426 predicted 1467
11 SASI_Mm01_00177427 predicted 325
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177725
VALIDATED
LRRC8A MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat containing 8 family, member A
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000258075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_177725.3-2359s21c1
Sequence:CCGGCTCTACACCTGGGCAACAATGCTCGAGCATTGTTGCCCAGGTGTAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250781    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_177725.3-250s21c1
Sequence:CCGGCCATCGTCATGCTGATGATTGCTCGAGCAATCATCAGCATGACGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_177725.3-1747s21c1
Sequence:CCGGACAACCGCTACATCGTCATTGCTCGAGCAATGACGATGTAGCGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250780    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_177725.3-2878s21c1
Sequence:CCGGTAACTTAGATCTGGGTATTTACTCGAGTAAATACCCAGATCTAAGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_177725.3-1911s21c1
Sequence:CCGGAGCCTCAAGAAGATGGTTAACCTCGAGGTTAACCATCTTCTTGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177725
VALIDATED
LRRC8A MISSION shRNA shRNA Plasmid DNA
leucine rich repeat containing 8 family, member A
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000258075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_177725.3-2359s21c1
Sequence:CCGGCTCTACACCTGGGCAACAATGCTCGAGCATTGTTGCCCAGGTGTAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250781    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_177725.3-250s21c1
Sequence:CCGGCCATCGTCATGCTGATGATTGCTCGAGCAATCATCAGCATGACGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_177725.3-1747s21c1
Sequence:CCGGACAACCGCTACATCGTCATTGCTCGAGCAATGACGATGTAGCGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250780    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_177725.3-2878s21c1
Sequence:CCGGTAACTTAGATCTGGGTATTTACTCGAGTAAATACCCAGATCTAAGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_177725.3-1911s21c1
Sequence:CCGGAGCCTCAAGAAGATGGTTAACCTCGAGGTTAACCATCTTCTTGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177725
VALIDATED
LRRC8A MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat containing 8 family, member A
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000258075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_177725.3-2359s21c1
Sequence:CCGGCTCTACACCTGGGCAACAATGCTCGAGCATTGTTGCCCAGGTGTAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250781    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_177725.3-250s21c1
Sequence:CCGGCCATCGTCATGCTGATGATTGCTCGAGCAATCATCAGCATGACGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_177725.3-1747s21c1
Sequence:CCGGACAACCGCTACATCGTCATTGCTCGAGCAATGACGATGTAGCGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250780    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_177725.3-2878s21c1
Sequence:CCGGTAACTTAGATCTGGGTATTTACTCGAGTAAATACCCAGATCTAAGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_177725.3-1911s21c1
Sequence:CCGGAGCCTCAAGAAGATGGTTAACCTCGAGGTTAACCATCTTCTTGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019594
VALIDATED
LRRC8A MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat containing 8 family, member A
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130750    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_019594.1-145s1c1
Sequence:CCGGGCACAACATCAAGTTCGACGTCTCGAGACGTCGAACTTGATGTTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019594.1-784s1c1
Sequence:CCGGCATCAAGTTCACCGACATCAACTCGAGTTGATGTCGGTGAACTTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019594.1-412s1c2
Sequence:CCGGGCTGCACCTCATTGACCAATACTCGAGTATTGGTCAATGAGGTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127644    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019594.1-391s1c1
Sequence:CCGGCAAGAACGACTTCGCCTTCATCTCGAGATGAAGGCGAAGTCGTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019594.1-994s1c2
Sequence:CCGGGCAGAAGCTGTCCATCAACAACTCGAGTTGTTGATGGACAGCTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127690    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019594.1-937s1c1
Sequence:CCGGGCTCAAGAGCAACCTAAGCAACTCGAGTTGCTTAGGTTGCTCTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019594.1-1297s1c2
Sequence:CCGGCCGCAACAAGATCGAGAAGATCTCGAGATCTTCTCGATCTTGTTGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127522    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019594.1-1298s1c1
Sequence:CCGGCGCAACAAGATCGAGAAGATCCTCGAGGATCTTCTCGATCTTGTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_019594.1-814s1c1
Sequence:CCGGGCTGTGGATCTATAGCCTGAACTCGAGTTCAGGCTATAGATCCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_019594.1-412s1c1
Sequence:CCGGGCTGCACCTCATTGACCAATACTCGAGTATTGGTCAATGAGGTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019594.1-994s1c1
Sequence:CCGGGCAGAAGCTGTCCATCAACAACTCGAGTTGTTGATGGACAGCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019594.1-121s1c1
Sequence:CCGGCATCTGCTACACCGTCTACTACTCGAGTAGTAGACGGTGTAGCAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_019594.1-1297s1c1
Sequence:CCGGCCGCAACAAGATCGAGAAGATCTCGAGATCTTCTCGATCTTGTTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019594
VALIDATED
LRRC8A MISSION shRNA shRNA Plasmid DNA
leucine rich repeat containing 8 family, member A
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130750    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_019594.1-145s1c1
Sequence:CCGGGCACAACATCAAGTTCGACGTCTCGAGACGTCGAACTTGATGTTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019594.1-784s1c1
Sequence:CCGGCATCAAGTTCACCGACATCAACTCGAGTTGATGTCGGTGAACTTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019594.1-412s1c2
Sequence:CCGGGCTGCACCTCATTGACCAATACTCGAGTATTGGTCAATGAGGTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127644    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019594.1-391s1c1
Sequence:CCGGCAAGAACGACTTCGCCTTCATCTCGAGATGAAGGCGAAGTCGTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019594.1-994s1c2
Sequence:CCGGGCAGAAGCTGTCCATCAACAACTCGAGTTGTTGATGGACAGCTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127690    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019594.1-937s1c1
Sequence:CCGGGCTCAAGAGCAACCTAAGCAACTCGAGTTGCTTAGGTTGCTCTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019594.1-1297s1c2
Sequence:CCGGCCGCAACAAGATCGAGAAGATCTCGAGATCTTCTCGATCTTGTTGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127522    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019594.1-1298s1c1
Sequence:CCGGCGCAACAAGATCGAGAAGATCCTCGAGGATCTTCTCGATCTTGTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_019594.1-814s1c1
Sequence:CCGGGCTGTGGATCTATAGCCTGAACTCGAGTTCAGGCTATAGATCCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_019594.1-412s1c1
Sequence:CCGGGCTGCACCTCATTGACCAATACTCGAGTATTGGTCAATGAGGTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019594.1-994s1c1
Sequence:CCGGGCAGAAGCTGTCCATCAACAACTCGAGTTGTTGATGGACAGCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019594.1-121s1c1
Sequence:CCGGCATCTGCTACACCGTCTACTACTCGAGTAGTAGACGGTGTAGCAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_019594.1-1297s1c1
Sequence:CCGGCCGCAACAAGATCGAGAAGATCTCGAGATCTTCTCGATCTTGTTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019594
VALIDATED
LRRC8A MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat containing 8 family, member A
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130750    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_019594.1-145s1c1
Sequence:CCGGGCACAACATCAAGTTCGACGTCTCGAGACGTCGAACTTGATGTTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019594.1-784s1c1
Sequence:CCGGCATCAAGTTCACCGACATCAACTCGAGTTGATGTCGGTGAACTTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019594.1-412s1c2
Sequence:CCGGGCTGCACCTCATTGACCAATACTCGAGTATTGGTCAATGAGGTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127644    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019594.1-391s1c1
Sequence:CCGGCAAGAACGACTTCGCCTTCATCTCGAGATGAAGGCGAAGTCGTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019594.1-994s1c2
Sequence:CCGGGCAGAAGCTGTCCATCAACAACTCGAGTTGTTGATGGACAGCTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127690    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019594.1-937s1c1
Sequence:CCGGGCTCAAGAGCAACCTAAGCAACTCGAGTTGCTTAGGTTGCTCTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019594.1-1297s1c2
Sequence:CCGGCCGCAACAAGATCGAGAAGATCTCGAGATCTTCTCGATCTTGTTGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127522    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019594.1-1298s1c1
Sequence:CCGGCGCAACAAGATCGAGAAGATCCTCGAGGATCTTCTCGATCTTGTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_019594.1-814s1c1
Sequence:CCGGGCTGTGGATCTATAGCCTGAACTCGAGTTCAGGCTATAGATCCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_019594.1-412s1c1
Sequence:CCGGGCTGCACCTCATTGACCAATACTCGAGTATTGGTCAATGAGGTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019594.1-994s1c1
Sequence:CCGGGCAGAAGCTGTCCATCAACAACTCGAGTTGTTGATGGACAGCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019594.1-121s1c1
Sequence:CCGGCATCTGCTACACCGTCTACTACTCGAGTAGTAGACGGTGTAGCAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_019594.1-1297s1c1
Sequence:CCGGCCGCAACAAGATCGAGAAGATCTCGAGATCTTCTCGATCTTGTTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks