EMAIL THIS PAGE TO A FRIEND

LRRIQ4

leucine-rich repeats and IQ motif containing 4

Synonyms: LRRC64
UniProtKB ID: A6NIV6
Gene ID:
Mouse(68307) leucine-rich repeats and IQ motif containing 4
Rat(100363341) leucine-rich repeats and IQ motif containing 4
domestic guinea pig(100728669) leucine-rich repeats and IQ motif containing 4
Domestic Rabbit(100345256) leucine-rich repeats and IQ motif containing 4
naked mole-rat(101721871) leucine-rich repeats and IQ motif containing 4
sheep(101120037) leucine-rich repeats and IQ motif containing 4
chicken(424995) leucine-rich repeats and IQ motif containing 4
dog(488152) leucine-rich repeats and IQ motif containing 4
cow(784301) leucine-rich repeats and IQ motif containing 4
Horse(100057487) leucine-rich repeats and IQ motif containing 4
domestic cat(101097339) leucine-rich repeats and IQ motif containing 4
41 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026668 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026668 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026668 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001080460 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001080460 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001080460 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU083741 MISSION® esiRNA esiRNA human LRRIQ4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080460 Rosetta Predictions human pricing
XM_293529 Rosetta Predictions human pricing
NM_026668 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080460 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00315046 predicted 1284
2 SASI_Hs02_00315047 predicted 1093
3 SASI_Hs02_00315048 predicted 1051
4 SASI_Hs02_00315049 predicted 1105
5 SASI_Hs02_00315050 predicted 1252
6 SASI_Hs02_00315051 predicted 638
7 SASI_Hs02_00315052 predicted 1072
8 SASI_Hs02_00315053 predicted 955
9 SASI_Hs02_00315054 predicted 1263
10 SASI_Hs02_00315055 predicted 498
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_293529 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00284745 predicted 1289
2 SASI_Hs01_00284746 predicted 1165
3 SASI_Hs01_00284747 predicted 1328
4 SASI_Hs01_00284748 predicted 1328
5 SASI_Hs01_00284749 predicted 1167
6 SASI_Hs01_00284750 predicted 1251
7 SASI_Hs01_00284751 predicted 1191
8 SASI_Hs01_00284752 predicted 1308
9 SASI_Hs01_00284753 predicted 1256
10 SASI_Hs01_00284754 predicted 1206
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026668 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00073308 predicted 1876
2 SASI_Mm01_00073309 predicted 1577
3 SASI_Mm01_00073310 predicted 1613
4 SASI_Mm01_00073311 predicted 1875
5 SASI_Mm01_00073312 predicted 1685
6 SASI_Mm01_00073313 predicted 1221
7 SASI_Mm02_00330668 predicted 564
8 SASI_Mm01_00073314 predicted 951
9 SASI_Mm01_00073315 predicted 1455
10 SASI_Mm01_00073316 predicted 580
11 SASI_Mm01_00073317 predicted 1817
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026668
LRRIQ4 MISSION shRNA Bacterial Glycerol Stock
leucine-rich repeats and IQ motif containing 4
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000175532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026668.1-1595s1c1
Sequence:CCGGCGAGCATAAGCTTGCTTTCAACTCGAGTTGAAAGCAAGCTTATGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026668.1-2141s1c1
Sequence:CCGGGATCTTATGAAGAGCTACTAACTCGAGTTAGTAGCTCTTCATAAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026668.1-1223s1c1
Sequence:CCGGCGTCTAACCACCTGATGAGTTCTCGAGAACTCATCAGGTGGTTAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026668.1-2128s1c1
Sequence:CCGGCGGAAAGGATATGGATCTTATCTCGAGATAAGATCCATATCCTTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194366    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026668.1-785s1c1
Sequence:CCGGCCAAGGTTCTCTACCTGCATACTCGAGTATGCAGGTAGAGAACCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193389    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026668.1-631s1c1
Sequence:CCGGCAGCTCACTGATAGAACATTTCTCGAGAAATGTTCTATCAGTGAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193608    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026668.1-1570s1c1
Sequence:CCGGGATAACAAAGTGAGGCAGTTACTCGAGTAACTGCCTCACTTTGTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193079    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026668.1-1852s1c2
Sequence:CCGGCGGCATAATCTTCTTAAGCAACTCGAGTTGCTTAAGAAGATTATGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215708    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026668.2-579s1c1
Sequence:CCGGCTACTGAGACAAGAACATTTACTCGAGTAAATGTTCTTGTCTCAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216147    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026668.2-1748s1c1
Sequence:CCGGCAAGAGATTGATGAATCTTAACTCGAGTTAAGATTCATCAATCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026668
LRRIQ4 MISSION shRNA shRNA Plasmid DNA
leucine-rich repeats and IQ motif containing 4
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000175532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026668.1-1595s1c1
Sequence:CCGGCGAGCATAAGCTTGCTTTCAACTCGAGTTGAAAGCAAGCTTATGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026668.1-2141s1c1
Sequence:CCGGGATCTTATGAAGAGCTACTAACTCGAGTTAGTAGCTCTTCATAAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026668.1-1223s1c1
Sequence:CCGGCGTCTAACCACCTGATGAGTTCTCGAGAACTCATCAGGTGGTTAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026668.1-2128s1c1
Sequence:CCGGCGGAAAGGATATGGATCTTATCTCGAGATAAGATCCATATCCTTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194366    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026668.1-785s1c1
Sequence:CCGGCCAAGGTTCTCTACCTGCATACTCGAGTATGCAGGTAGAGAACCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193389    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026668.1-631s1c1
Sequence:CCGGCAGCTCACTGATAGAACATTTCTCGAGAAATGTTCTATCAGTGAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193608    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026668.1-1570s1c1
Sequence:CCGGGATAACAAAGTGAGGCAGTTACTCGAGTAACTGCCTCACTTTGTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193079    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026668.1-1852s1c2
Sequence:CCGGCGGCATAATCTTCTTAAGCAACTCGAGTTGCTTAAGAAGATTATGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215708    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026668.2-579s1c1
Sequence:CCGGCTACTGAGACAAGAACATTTACTCGAGTAAATGTTCTTGTCTCAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216147    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026668.2-1748s1c1
Sequence:CCGGCAAGAGATTGATGAATCTTAACTCGAGTTAAGATTCATCAATCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026668
LRRIQ4 MISSION shRNA Lentiviral Transduction Particles
leucine-rich repeats and IQ motif containing 4
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000175532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026668.1-1595s1c1
Sequence:CCGGCGAGCATAAGCTTGCTTTCAACTCGAGTTGAAAGCAAGCTTATGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026668.1-2141s1c1
Sequence:CCGGGATCTTATGAAGAGCTACTAACTCGAGTTAGTAGCTCTTCATAAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026668.1-1223s1c1
Sequence:CCGGCGTCTAACCACCTGATGAGTTCTCGAGAACTCATCAGGTGGTTAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026668.1-2128s1c1
Sequence:CCGGCGGAAAGGATATGGATCTTATCTCGAGATAAGATCCATATCCTTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194366    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026668.1-785s1c1
Sequence:CCGGCCAAGGTTCTCTACCTGCATACTCGAGTATGCAGGTAGAGAACCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193389    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026668.1-631s1c1
Sequence:CCGGCAGCTCACTGATAGAACATTTCTCGAGAAATGTTCTATCAGTGAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193608    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026668.1-1570s1c1
Sequence:CCGGGATAACAAAGTGAGGCAGTTACTCGAGTAACTGCCTCACTTTGTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193079    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026668.1-1852s1c2
Sequence:CCGGCGGCATAATCTTCTTAAGCAACTCGAGTTGCTTAAGAAGATTATGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215708    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026668.2-579s1c1
Sequence:CCGGCTACTGAGACAAGAACATTTACTCGAGTAAATGTTCTTGTCTCAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216147    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026668.2-1748s1c1
Sequence:CCGGCAAGAGATTGATGAATCTTAACTCGAGTTAAGATTCATCAATCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080460
LRRIQ4 MISSION shRNA Bacterial Glycerol Stock
leucine-rich repeats and IQ motif containing 4
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000245900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080460.1-1194s21c1
Sequence:CCGGGAGTCTCAAAGAGCTATATATCTCGAGATATATAGCTCTTTGAGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080460.1-705s21c1
Sequence:CCGGACTGTCGGTGCTCGATTTATCCTCGAGGATAAATCGAGCACCGACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080460.1-53s21c1
Sequence:CCGGATGATCCACAGCACGTCAATGCTCGAGCATTGACGTGCTGTGGATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080460.1-1275s21c1
Sequence:CCGGTCTTGATTGCCGGCACAATTTCTCGAGAAATTGTGCCGGCAATCAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080460
LRRIQ4 MISSION shRNA shRNA Plasmid DNA
leucine-rich repeats and IQ motif containing 4
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000245900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080460.1-1194s21c1
Sequence:CCGGGAGTCTCAAAGAGCTATATATCTCGAGATATATAGCTCTTTGAGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080460.1-705s21c1
Sequence:CCGGACTGTCGGTGCTCGATTTATCCTCGAGGATAAATCGAGCACCGACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080460.1-53s21c1
Sequence:CCGGATGATCCACAGCACGTCAATGCTCGAGCATTGACGTGCTGTGGATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080460.1-1275s21c1
Sequence:CCGGTCTTGATTGCCGGCACAATTTCTCGAGAAATTGTGCCGGCAATCAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080460
LRRIQ4 MISSION shRNA Lentiviral Transduction Particles
leucine-rich repeats and IQ motif containing 4
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000245900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080460.1-1194s21c1
Sequence:CCGGGAGTCTCAAAGAGCTATATATCTCGAGATATATAGCTCTTTGAGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080460.1-705s21c1
Sequence:CCGGACTGTCGGTGCTCGATTTATCCTCGAGGATAAATCGAGCACCGACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080460.1-53s21c1
Sequence:CCGGATGATCCACAGCACGTCAATGCTCGAGCATTGACGTGCTGTGGATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080460.1-1275s21c1
Sequence:CCGGTCTTGATTGCCGGCACAATTTCTCGAGAAATTGTGCCGGCAATCAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks