EMAIL THIS PAGE TO A FRIEND

LSM10

LSM10, U7 small nuclear RNA associated

Synonyms: MST074 MSTP074
UniProtKB ID: Q969L4
Gene ID:
Mouse(116748) U7 snRNP-specific Sm-like protein LSM10
Rat(366468) LSM10, U7 small nuclear RNA associated
domestic guinea pig(100730739) LSM10, U7 small nuclear RNA associated
naked mole-rat(101721611) LSM10, U7 small nuclear RNA associated
sheep(101113285) LSM10, U7 small nuclear RNA associated
fruit fly(36141) CG12938 gene product from transcript CG12938-RA
chicken(419621) LSM10, U7 small nuclear RNA associated
domestic cat(101087590) LSM10, U7 small nuclear RNA associated
cow(618089) LSM10, U7 small nuclear RNA associated
dog(475335) LSM10, U7 small nuclear RNA associated
47 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138721 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_138721 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_138721 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032881 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032881 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032881 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032881 Rosetta Predictions human pricing
NM_001108976 Rosetta Predictions rat pricing
NM_138721 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032881 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00233251 predicted 274
2 SASI_Hs01_00233252 predicted 458
3 SASI_Hs02_00360498 predicted 376
4 SASI_Hs01_00233253 predicted 404
5 SASI_Hs01_00233254 predicted 359
6 SASI_Hs02_00360499 predicted 352
7 SASI_Hs01_00233256 predicted 272
8 SASI_Hs01_00233257 predicted 387
9 SASI_Hs01_00233259 predicted 555
10 SASI_Hs01_00233260 predicted 452
11 SASI_Hs01_00233255 predicted 555
12 SASI_Hs01_00233258 predicted 354
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108976 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00243944 predicted 591
2 SASI_Rn02_00243945 predicted 477
3 SASI_Rn02_00243946 predicted 192
4 SASI_Rn02_00243947 predicted 309
5 SASI_Rn02_00243948 predicted 335
6 SASI_Rn02_00243949 predicted 302
7 SASI_Rn02_00243950 predicted 476
8 SASI_Rn02_00243951 predicted 565
9 SASI_Rn02_00243952 predicted 561
10 SASI_Rn02_00243953 predicted 199
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138721 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00153059 predicted 342
2 SASI_Mm01_00153060 predicted 310
3 SASI_Mm01_00153061 predicted 210
4 SASI_Mm01_00153063 predicted 541
5 SASI_Mm01_00153064 predicted 547
6 SASI_Mm01_00153066 predicted 270
7 SASI_Mm01_00153067 predicted 337
8 SASI_Mm01_00153068 predicted 441
9 SASI_Mm02_00339786 predicted 460
10 SASI_Mm02_00339787 predicted 500
11 SASI_Mm01_00153062 predicted 411
12 SASI_Mm01_00153065 predicted 551
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138721
VALIDATED
LSM10 MISSION shRNA Bacterial Glycerol Stock
LSM10, U7 small nuclear RNA associated
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000123526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138721.1-278s1c1
Sequence:CCGGCAGGTTGAGTTGGATGACCTTCTCGAGAAGGTCATCCAACTCAACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138721.1-240s1c1
Sequence:CCGGGCCTGGCCAATGTCACCTATACTCGAGTATAGGTGACATTGGCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123524    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138721.1-555s1c1
Sequence:CCGGCCTTTCGTAGGGTTCCAGTTTCTCGAGAAACTGGAACCCTACGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138721.1-320s1c1
Sequence:CCGGCGATACGTCCATATCCCAGATCTCGAGATCTGGGATATGGACGTATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138721.1-342s1c1
Sequence:CCGGGTGTGGACATCACTGCTACTACTCGAGTAGTAGCAGTGATGTCCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138721.1-342s21c1
Sequence:CCGGGTGTGGACATCACTGCTACTACTCGAGTAGTAGCAGTGATGTCCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138721.1-278s21c1
Sequence:CCGGCAGGTTGAGTTGGATGACCTTCTCGAGAAGGTCATCCAACTCAACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294729    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138721.1-644s21c1
Sequence:CCGGGGATCATTTGTATCTCGAATCCTCGAGGATTCGAGATACAAATGATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138721.1-449s21c1
Sequence:CCGGTGAGACTGTGCCCTCGTTAAACTCGAGTTTAACGAGGGCACAGTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138721.1-147s21c1
Sequence:CCGGAGGGCCTCCAAGGCCAAATAACTCGAGTTATTTGGCCTTGGAGGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138721
VALIDATED
LSM10 MISSION shRNA shRNA Plasmid DNA
LSM10, U7 small nuclear RNA associated
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000123526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138721.1-278s1c1
Sequence:CCGGCAGGTTGAGTTGGATGACCTTCTCGAGAAGGTCATCCAACTCAACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138721.1-240s1c1
Sequence:CCGGGCCTGGCCAATGTCACCTATACTCGAGTATAGGTGACATTGGCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123524    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138721.1-555s1c1
Sequence:CCGGCCTTTCGTAGGGTTCCAGTTTCTCGAGAAACTGGAACCCTACGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138721.1-320s1c1
Sequence:CCGGCGATACGTCCATATCCCAGATCTCGAGATCTGGGATATGGACGTATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138721.1-342s1c1
Sequence:CCGGGTGTGGACATCACTGCTACTACTCGAGTAGTAGCAGTGATGTCCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138721.1-342s21c1
Sequence:CCGGGTGTGGACATCACTGCTACTACTCGAGTAGTAGCAGTGATGTCCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138721.1-278s21c1
Sequence:CCGGCAGGTTGAGTTGGATGACCTTCTCGAGAAGGTCATCCAACTCAACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294729    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138721.1-644s21c1
Sequence:CCGGGGATCATTTGTATCTCGAATCCTCGAGGATTCGAGATACAAATGATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138721.1-449s21c1
Sequence:CCGGTGAGACTGTGCCCTCGTTAAACTCGAGTTTAACGAGGGCACAGTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138721.1-147s21c1
Sequence:CCGGAGGGCCTCCAAGGCCAAATAACTCGAGTTATTTGGCCTTGGAGGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138721
VALIDATED
LSM10 MISSION shRNA Lentiviral Transduction Particles
LSM10, U7 small nuclear RNA associated
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000123526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138721.1-278s1c1
Sequence:CCGGCAGGTTGAGTTGGATGACCTTCTCGAGAAGGTCATCCAACTCAACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138721.1-240s1c1
Sequence:CCGGGCCTGGCCAATGTCACCTATACTCGAGTATAGGTGACATTGGCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123524    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138721.1-555s1c1
Sequence:CCGGCCTTTCGTAGGGTTCCAGTTTCTCGAGAAACTGGAACCCTACGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138721.1-320s1c1
Sequence:CCGGCGATACGTCCATATCCCAGATCTCGAGATCTGGGATATGGACGTATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138721.1-342s1c1
Sequence:CCGGGTGTGGACATCACTGCTACTACTCGAGTAGTAGCAGTGATGTCCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138721.1-342s21c1
Sequence:CCGGGTGTGGACATCACTGCTACTACTCGAGTAGTAGCAGTGATGTCCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138721.1-278s21c1
Sequence:CCGGCAGGTTGAGTTGGATGACCTTCTCGAGAAGGTCATCCAACTCAACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294729    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138721.1-644s21c1
Sequence:CCGGGGATCATTTGTATCTCGAATCCTCGAGGATTCGAGATACAAATGATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138721.1-449s21c1
Sequence:CCGGTGAGACTGTGCCCTCGTTAAACTCGAGTTTAACGAGGGCACAGTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138721.1-147s21c1
Sequence:CCGGAGGGCCTCCAAGGCCAAATAACTCGAGTTATTTGGCCTTGGAGGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032881
VALIDATED
LSM10 MISSION shRNA Bacterial Glycerol Stock
LSM10, U7 small nuclear RNA associated
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000074413    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A3
TRC Version: 1 Clone ID:NM_032881.1-653s1c1
Sequence:CCGGCCACCTGTCAAAGCTGCCTTTCTCGAGAAAGGCAGCTTTGACAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A3
TRC Version: 1 Clone ID:NM_032881.1-276s1c1
Sequence:CCGGCATAGACAATGTCGATGCTTTCTCGAGAAAGCATCGACATTGTCTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A3
TRC Version: 1 Clone ID:NM_032881.1-447s1c1
Sequence:CCGGGATTATCCATCGGGTGCGAAACTCGAGTTTCGCACCCGATGGATAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_032881.1-399s1c1
Sequence:CCGGCATCCCAGATGACGTGAACATCTCGAGATGTTCACGTCATCTGGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074414    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A3
TRC Version: 1 Clone ID:NM_032881.1-275s1c1
Sequence:CCGGGCATAGACAATGTCGATGCTTCTCGAGAAGCATCGACATTGTCTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000439963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032881.1-514s21c1
Sequence:CCGGTGTAAGTGAGGCCCTCAGCAACTCGAGTTGCTGAGGGCCTCACTTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032881.1-285s21c1
Sequence:CCGGTGTCGATGCTTTCATGAACATCTCGAGATGTTCATGAAAGCATCGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032881.1-176s21c1
Sequence:CCGGAGCGGACCATCTCTGAGAACACTCGAGTGTTCTCAGAGATGGTCCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032881
VALIDATED
LSM10 MISSION shRNA shRNA Plasmid DNA
LSM10, U7 small nuclear RNA associated
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000074413    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A3
TRC Version: 1 Clone ID:NM_032881.1-653s1c1
Sequence:CCGGCCACCTGTCAAAGCTGCCTTTCTCGAGAAAGGCAGCTTTGACAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A3
TRC Version: 1 Clone ID:NM_032881.1-276s1c1
Sequence:CCGGCATAGACAATGTCGATGCTTTCTCGAGAAAGCATCGACATTGTCTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A3
TRC Version: 1 Clone ID:NM_032881.1-447s1c1
Sequence:CCGGGATTATCCATCGGGTGCGAAACTCGAGTTTCGCACCCGATGGATAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_032881.1-399s1c1
Sequence:CCGGCATCCCAGATGACGTGAACATCTCGAGATGTTCACGTCATCTGGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074414    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A3
TRC Version: 1 Clone ID:NM_032881.1-275s1c1
Sequence:CCGGGCATAGACAATGTCGATGCTTCTCGAGAAGCATCGACATTGTCTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000439963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032881.1-514s21c1
Sequence:CCGGTGTAAGTGAGGCCCTCAGCAACTCGAGTTGCTGAGGGCCTCACTTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032881.1-285s21c1
Sequence:CCGGTGTCGATGCTTTCATGAACATCTCGAGATGTTCATGAAAGCATCGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032881.1-176s21c1
Sequence:CCGGAGCGGACCATCTCTGAGAACACTCGAGTGTTCTCAGAGATGGTCCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032881
VALIDATED
LSM10 MISSION shRNA Lentiviral Transduction Particles
LSM10, U7 small nuclear RNA associated
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000074413    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A3
TRC Version: 1 Clone ID:NM_032881.1-653s1c1
Sequence:CCGGCCACCTGTCAAAGCTGCCTTTCTCGAGAAAGGCAGCTTTGACAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A3
TRC Version: 1 Clone ID:NM_032881.1-276s1c1
Sequence:CCGGCATAGACAATGTCGATGCTTTCTCGAGAAAGCATCGACATTGTCTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A3
TRC Version: 1 Clone ID:NM_032881.1-447s1c1
Sequence:CCGGGATTATCCATCGGGTGCGAAACTCGAGTTTCGCACCCGATGGATAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_032881.1-399s1c1
Sequence:CCGGCATCCCAGATGACGTGAACATCTCGAGATGTTCACGTCATCTGGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074414    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A3
TRC Version: 1 Clone ID:NM_032881.1-275s1c1
Sequence:CCGGGCATAGACAATGTCGATGCTTCTCGAGAAGCATCGACATTGTCTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000439963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032881.1-514s21c1
Sequence:CCGGTGTAAGTGAGGCCCTCAGCAACTCGAGTTGCTGAGGGCCTCACTTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032881.1-285s21c1
Sequence:CCGGTGTCGATGCTTTCATGAACATCTCGAGATGTTCATGAAAGCATCGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032881.1-176s21c1
Sequence:CCGGAGCGGACCATCTCTGAGAACACTCGAGTGTTCTCAGAGATGGTCCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks