EMAIL THIS PAGE TO A FRIEND

LSM3

LSM3 homolog, U6 small nuclear RNA associated (S. cerevisiae)

Synonyms: SMX4 USS2 YLR438C
UniProtKB ID: P62310, Q6IAH0, Q9Y4Z1
Gene ID:
Human(27258) Summary: Sm-like proteins were identified in a variety of organisms based on sequence homology with the Sm protein family (see SNRPD2; MIM 601061). Sm-like proteins contain the Sm sequence motif, which consists of 2 regions separated by a linker of variable length that folds as a loop. The Sm-like proteins are thought to form a stable heteromer present in tri-snRNP particles, which are important for pre-mRNA splicing.[supplied by OMIM, Apr 2004]
Mouse(67678) LSM3 homolog, U6 small nuclear RNA associated (S. cerevisiae)
Rat(297455) LSM3 homolog, U6 small nuclear RNA associated (S. cerevisiae)
fruit fly(42842) CG31184 gene product from transcript CG31184-RA
dog(607248) LSM3 homolog, U6 small nuclear RNA associated (S. cerevisiae)
cow(614759) LSM3 homolog, U6 small nuclear RNA associated (S. cerevisiae)
domestic cat(101101627) LSM3 homolog, U6 small nuclear RNA associated (S. cerevisiae)
chicken(416040) LSM3 homolog, U6 small nuclear RNA associated (S. cerevisiae)
domestic guinea pig(100723331) LSM3 homolog, U6 small nuclear RNA associated (S. cerevisiae)
naked mole-rat(101708310) LSM3 homolog, U6 small nuclear RNA associated (S. cerevisiae)
sheep(101105285) LSM3 homolog, U6 small nuclear RNA associated (S. cerevisiae)
63 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026309 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026309 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026309 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014463 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014463 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014463 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014463 Rosetta Predictions human pricing
NM_001106611 Rosetta Predictions rat pricing
NM_026309 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014463 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00109562 predicted 316
2 SASI_Hs01_00109565 predicted 326
3 SASI_Hs01_00109567 predicted 258
4 SASI_Hs02_00345683 predicted 318
5 SASI_Hs01_00109563 predicted 218
6 SASI_Hs01_00109564 predicted 207
7 SASI_Hs02_00345684 predicted 262
8 SASI_Hs01_00109566 predicted 235
9 SASI_Hs01_00109568 predicted 198
10 SASI_Hs01_00109569 predicted 245
11 SASI_Hs01_00109570 predicted 325
12 SASI_Hs01_00109571 predicted 238
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106611 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00220648 predicted 205
2 SASI_Rn02_00220649 predicted 237
3 SASI_Rn02_00220650 predicted 231
4 SASI_Rn02_00220651 predicted 470
5 SASI_Rn02_00220652 predicted 300
6 SASI_Rn02_00220653 predicted 234
7 SASI_Rn02_00220654 predicted 216
8 SASI_Rn02_00220655 predicted 280
9 SASI_Rn02_00220656 predicted 213
10 SASI_Rn02_00220657 predicted 356
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026309 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00080089 predicted 232
2 SASI_Mm01_00080090 predicted 392
3 SASI_Mm01_00080091 predicted 406
4 SASI_Mm02_00330010 predicted 216
5 SASI_Mm01_00080092 predicted 393
6 SASI_Mm02_00330011 predicted 200
7 SASI_Mm01_00080094 predicted 312
8 SASI_Mm02_00330012 predicted 231
9 SASI_Mm01_00080095 predicted 366
10 SASI_Mm02_00330013 predicted 202
11 SASI_Mm01_00080093 predicted 373
12 SASI_Mm01_00080096 predicted 294
13 SASI_Mm01_00080097 predicted 373
14 SASI_Mm01_00080098 predicted 356
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026309
VALIDATED
LSM3 MISSION shRNA Bacterial Glycerol Stock
LSM3 homolog, U6 small nuclear RNA associated (S. cerevisiae)
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000109100    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026309.1-418s1c1
Sequence:CCGGCGAATCCTGATAGTCAGAAATCTCGAGATTTCTGACTATCAGGATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026309.1-102s1c1
Sequence:CCGGGATGAGCGAATTTATGTGAAACTCGAGTTTCACATAAATTCGCTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026309.1-96s1c1
Sequence:CCGGAGCCTGGATGAGCGAATTTATCTCGAGATAAATTCGCTCATCCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026309.1-228s1c1
Sequence:CCGGGAGGAGACATATGAAGAGATACTCGAGTATCTCTTCATATGTCTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026309.2-204s21c1
Sequence:CCGGGTGACAACGATAGAGATTGATCTCGAGATCAATCTCTATCGTTGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026309.2-225s21c1
Sequence:CCGGGAGGAGACATATGAAGAGATACTCGAGTATCTCTTCATATGTCTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309160    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026309.2-415s21c1
Sequence:CCGGCGAATCCTGATAGTCAGAAATCTCGAGATTTCTGACTATCAGGATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026309.2-93s21c1
Sequence:CCGGAGCCTGGATGAGCGAATTTATCTCGAGATAAATTCGCTCATCCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026309
VALIDATED
LSM3 MISSION shRNA shRNA Plasmid DNA
LSM3 homolog, U6 small nuclear RNA associated (S. cerevisiae)
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000109100    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026309.1-418s1c1
Sequence:CCGGCGAATCCTGATAGTCAGAAATCTCGAGATTTCTGACTATCAGGATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026309.1-102s1c1
Sequence:CCGGGATGAGCGAATTTATGTGAAACTCGAGTTTCACATAAATTCGCTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026309.1-96s1c1
Sequence:CCGGAGCCTGGATGAGCGAATTTATCTCGAGATAAATTCGCTCATCCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026309.1-228s1c1
Sequence:CCGGGAGGAGACATATGAAGAGATACTCGAGTATCTCTTCATATGTCTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026309.2-204s21c1
Sequence:CCGGGTGACAACGATAGAGATTGATCTCGAGATCAATCTCTATCGTTGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026309.2-225s21c1
Sequence:CCGGGAGGAGACATATGAAGAGATACTCGAGTATCTCTTCATATGTCTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309160    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026309.2-415s21c1
Sequence:CCGGCGAATCCTGATAGTCAGAAATCTCGAGATTTCTGACTATCAGGATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026309.2-93s21c1
Sequence:CCGGAGCCTGGATGAGCGAATTTATCTCGAGATAAATTCGCTCATCCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026309
VALIDATED
LSM3 MISSION shRNA Lentiviral Transduction Particles
LSM3 homolog, U6 small nuclear RNA associated (S. cerevisiae)
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000109100    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026309.1-418s1c1
Sequence:CCGGCGAATCCTGATAGTCAGAAATCTCGAGATTTCTGACTATCAGGATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026309.1-102s1c1
Sequence:CCGGGATGAGCGAATTTATGTGAAACTCGAGTTTCACATAAATTCGCTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026309.1-96s1c1
Sequence:CCGGAGCCTGGATGAGCGAATTTATCTCGAGATAAATTCGCTCATCCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026309.1-228s1c1
Sequence:CCGGGAGGAGACATATGAAGAGATACTCGAGTATCTCTTCATATGTCTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026309.2-204s21c1
Sequence:CCGGGTGACAACGATAGAGATTGATCTCGAGATCAATCTCTATCGTTGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026309.2-225s21c1
Sequence:CCGGGAGGAGACATATGAAGAGATACTCGAGTATCTCTTCATATGTCTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309160    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026309.2-415s21c1
Sequence:CCGGCGAATCCTGATAGTCAGAAATCTCGAGATTTCTGACTATCAGGATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026309.2-93s21c1
Sequence:CCGGAGCCTGGATGAGCGAATTTATCTCGAGATAAATTCGCTCATCCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014463
VALIDATED
LSM3 MISSION shRNA Bacterial Glycerol Stock
LSM3 homolog, U6 small nuclear RNA associated (S. cerevisiae)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000072318    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014463.1-373s1c1
Sequence:CCGGCTTTGTACAGTGGCCTCTCTACTCGAGTAGAGAGGCCACTGTACAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014463.1-201s1c1
Sequence:CCGGGAAGAAACTGTGACTACTATACTCGAGTATAGTAGTCACAGTTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014463.1-147s1c1
Sequence:CCGGCGAGGCAGATTACATGCTTATCTCGAGATAAGCATGTAATCTGCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014463.1-96s1c1
Sequence:CCGGCTCAGCCTAGATGAGCGAATTCTCGAGAATTCGCTCATCTAGGCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014463.1-267s1c1
Sequence:CCGGCGGAATATTCCAATGCTCTTTCTCGAGAAAGAGCATTGGAATATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014463.1-267s21c1
Sequence:CCGGCGGAATATTCCAATGCTCTTTCTCGAGAAAGAGCATTGGAATATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014463.1-147s21c1
Sequence:CCGGCGAGGCAGATTACATGCTTATCTCGAGATAAGCATGTAATCTGCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289547    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014463.1-373s21c1
Sequence:CCGGCTTTGTACAGTGGCCTCTCTACTCGAGTAGAGAGGCCACTGTACAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014463.1-96s21c1
Sequence:CCGGCTCAGCCTAGATGAGCGAATTCTCGAGAATTCGCTCATCTAGGCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014463.1-201s21c1
Sequence:CCGGGAAGAAACTGTGACTACTATACTCGAGTATAGTAGTCACAGTTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014463
VALIDATED
LSM3 MISSION shRNA shRNA Plasmid DNA
LSM3 homolog, U6 small nuclear RNA associated (S. cerevisiae)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000072318    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014463.1-373s1c1
Sequence:CCGGCTTTGTACAGTGGCCTCTCTACTCGAGTAGAGAGGCCACTGTACAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014463.1-201s1c1
Sequence:CCGGGAAGAAACTGTGACTACTATACTCGAGTATAGTAGTCACAGTTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014463.1-147s1c1
Sequence:CCGGCGAGGCAGATTACATGCTTATCTCGAGATAAGCATGTAATCTGCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014463.1-96s1c1
Sequence:CCGGCTCAGCCTAGATGAGCGAATTCTCGAGAATTCGCTCATCTAGGCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014463.1-267s1c1
Sequence:CCGGCGGAATATTCCAATGCTCTTTCTCGAGAAAGAGCATTGGAATATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014463.1-267s21c1
Sequence:CCGGCGGAATATTCCAATGCTCTTTCTCGAGAAAGAGCATTGGAATATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014463.1-147s21c1
Sequence:CCGGCGAGGCAGATTACATGCTTATCTCGAGATAAGCATGTAATCTGCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289547    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014463.1-373s21c1
Sequence:CCGGCTTTGTACAGTGGCCTCTCTACTCGAGTAGAGAGGCCACTGTACAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014463.1-96s21c1
Sequence:CCGGCTCAGCCTAGATGAGCGAATTCTCGAGAATTCGCTCATCTAGGCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014463.1-201s21c1
Sequence:CCGGGAAGAAACTGTGACTACTATACTCGAGTATAGTAGTCACAGTTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014463
VALIDATED
LSM3 MISSION shRNA Lentiviral Transduction Particles
LSM3 homolog, U6 small nuclear RNA associated (S. cerevisiae)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000072318    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014463.1-373s1c1
Sequence:CCGGCTTTGTACAGTGGCCTCTCTACTCGAGTAGAGAGGCCACTGTACAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014463.1-201s1c1
Sequence:CCGGGAAGAAACTGTGACTACTATACTCGAGTATAGTAGTCACAGTTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014463.1-147s1c1
Sequence:CCGGCGAGGCAGATTACATGCTTATCTCGAGATAAGCATGTAATCTGCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014463.1-96s1c1
Sequence:CCGGCTCAGCCTAGATGAGCGAATTCTCGAGAATTCGCTCATCTAGGCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014463.1-267s1c1
Sequence:CCGGCGGAATATTCCAATGCTCTTTCTCGAGAAAGAGCATTGGAATATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014463.1-267s21c1
Sequence:CCGGCGGAATATTCCAATGCTCTTTCTCGAGAAAGAGCATTGGAATATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014463.1-147s21c1
Sequence:CCGGCGAGGCAGATTACATGCTTATCTCGAGATAAGCATGTAATCTGCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289547    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014463.1-373s21c1
Sequence:CCGGCTTTGTACAGTGGCCTCTCTACTCGAGTAGAGAGGCCACTGTACAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014463.1-96s21c1
Sequence:CCGGCTCAGCCTAGATGAGCGAATTCTCGAGAATTCGCTCATCTAGGCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014463.1-201s21c1
Sequence:CCGGGAAGAAACTGTGACTACTATACTCGAGTATAGTAGTCACAGTTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks