EMAIL THIS PAGE TO A FRIEND

LSM5

LSM5 homolog, U6 small nuclear RNA associated (S. cerevisiae)

Synonyms: YER146W
UniProtKB ID: Q9Y4Y9
Gene ID:
Human(23658) Summary: Sm-like proteins were identified in a variety of organisms based on sequence homology with the Sm protein family (see SNRPD2; MIM 601061). Sm-like proteins contain the Sm sequence motif, which consists of 2 regions separated by a linker of variable length that folds as a loop. The Sm-like proteins are thought to form a stable heteromer present in tri-snRNP particles, which are important for pre-mRNA splicing.[supplied by OMIM, Apr 2004]
Mouse(66373) LSM5 homolog, U6 small nuclear RNA associated (S. cerevisiae)
Rat(306222) LSM5 homolog, U6 small nuclear RNA associated (S. cerevisiae)
domestic guinea pig(100722260) LSM5 homolog, U6 small nuclear RNA associated (S. cerevisiae)
naked mole-rat(101720314) LSM5 homolog, U6 small nuclear RNA associated (S. cerevisiae)
sheep(101121254) LSM5 homolog, U6 small nuclear RNA associated (S. cerevisiae)
chicken(420751) LSM5 homolog, U6 small nuclear RNA associated (S. cerevisiae)
dog(611686) LSM5 homolog, U6 small nuclear RNA associated (S. cerevisiae)
cow(615136) LSM5 homolog, U6 small nuclear RNA associated (S. cerevisiae)
domestic cat(101090251) LSM5 homolog, U6 small nuclear RNA associated (S. cerevisiae)
78 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025520 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025520 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025520 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_012322 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012322 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012322 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU129931 MISSION® esiRNA esiRNA human LSM5 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012322 Rosetta Predictions human pricing
NM_001107289 Rosetta Predictions rat pricing
NM_025520 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012322 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00207344 predicted 121
2 SASI_Hs01_00207345 predicted 376
3 SASI_Hs02_00344108 predicted 278
4 SASI_Hs01_00207346 predicted 653
5 SASI_Hs01_00207347 predicted 32
6 SASI_Hs01_00207348 predicted 147
7 SASI_Hs01_00207349 predicted 353
8 SASI_Hs01_00207350 predicted 382
9 SASI_Hs01_00207351 predicted 396
10 SASI_Hs01_00207352 predicted 193
11 SASI_Hs01_00207353 predicted 192
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107289 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00227375 predicted 299
2 SASI_Rn02_00227376 predicted 308
3 SASI_Rn02_00227377 predicted 309
4 SASI_Rn02_00227378 predicted 311
5 SASI_Rn02_00227379 predicted 284
6 SASI_Rn02_00227380 predicted 258
7 SASI_Rn02_00227381 predicted 208
8 SASI_Rn02_00227382 predicted 300
9 SASI_Rn02_00227383 predicted 199
10 SASI_Rn02_00227384 predicted 200
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025520 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00328421 predicted 204
2 SASI_Mm02_00328422 predicted 232
3 SASI_Mm02_00328423 predicted 195
4 SASI_Mm02_00328424 predicted 230
5 SASI_Mm02_00328425 predicted 230
6 SASI_Mm02_00328426 predicted 210
7 SASI_Mm01_00041444 predicted 50
8 SASI_Mm01_00041445 predicted 288
9 SASI_Mm01_00041446 predicted 340
10 SASI_Mm01_00041447 predicted 147
11 SASI_Mm01_00041448 predicted 178
12 SASI_Mm01_00041449 predicted 93
13 SASI_Mm01_00041450 predicted 59
14 SASI_Mm01_00041451 predicted 393
15 SASI_Mm01_00041452 predicted 81
16 SASI_Mm01_00041453 predicted 354
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025520
VALIDATED
LSM5 MISSION shRNA Bacterial Glycerol Stock
LSM5 homolog, U6 small nuclear RNA associated (S. cerevisiae)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000109195    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025520.2-358s1c1
Sequence:CCGGAGGGAAACTCTTTGAAGATATCTCGAGATATCTTCAAAGAGTTTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109196    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025520.2-55s1c1
Sequence:CCGGCCACTAGAGCTTGTGGACAAACTCGAGTTTGTCCACAAGCTCTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025520.2-164s1c1
Sequence:CCGGTGTTGGAAGATGTCACAGAATCTCGAGATTCTGTGACATCTTCCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025520.2-194s1c1
Sequence:CCGGCACCAGAAGGAAGAAGAATTACTCGAGTAATTCTTCTTCCTTCTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109198    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025520.2-72s1c1
Sequence:CCGGCAAATGTATAGGGTCAAGAATCTCGAGATTCTTGACCCTATACATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025520
VALIDATED
LSM5 MISSION shRNA shRNA Plasmid DNA
LSM5 homolog, U6 small nuclear RNA associated (S. cerevisiae)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000109195    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025520.2-358s1c1
Sequence:CCGGAGGGAAACTCTTTGAAGATATCTCGAGATATCTTCAAAGAGTTTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109196    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025520.2-55s1c1
Sequence:CCGGCCACTAGAGCTTGTGGACAAACTCGAGTTTGTCCACAAGCTCTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025520.2-164s1c1
Sequence:CCGGTGTTGGAAGATGTCACAGAATCTCGAGATTCTGTGACATCTTCCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025520.2-194s1c1
Sequence:CCGGCACCAGAAGGAAGAAGAATTACTCGAGTAATTCTTCTTCCTTCTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109198    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025520.2-72s1c1
Sequence:CCGGCAAATGTATAGGGTCAAGAATCTCGAGATTCTTGACCCTATACATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025520
VALIDATED
LSM5 MISSION shRNA Lentiviral Transduction Particles
LSM5 homolog, U6 small nuclear RNA associated (S. cerevisiae)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000109195    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025520.2-358s1c1
Sequence:CCGGAGGGAAACTCTTTGAAGATATCTCGAGATATCTTCAAAGAGTTTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109196    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025520.2-55s1c1
Sequence:CCGGCCACTAGAGCTTGTGGACAAACTCGAGTTTGTCCACAAGCTCTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025520.2-164s1c1
Sequence:CCGGTGTTGGAAGATGTCACAGAATCTCGAGATTCTGTGACATCTTCCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025520.2-194s1c1
Sequence:CCGGCACCAGAAGGAAGAAGAATTACTCGAGTAATTCTTCTTCCTTCTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109198    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025520.2-72s1c1
Sequence:CCGGCAAATGTATAGGGTCAAGAATCTCGAGATTCTTGACCCTATACATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012322
VALIDATED
LSM5 MISSION shRNA Bacterial Glycerol Stock
LSM5 homolog, U6 small nuclear RNA associated (S. cerevisiae)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000074453    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_012322.1-398s1c1
Sequence:CCGGGCTTTGAAGATGTGTACCCATCTCGAGATGGGTACACATCTTCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_012322.1-40s1c1
Sequence:CCGGCCGTTAGAGCTTGTGGACAAACTCGAGTTTGTCCACAAGCTCTAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_012322.1-81s1c1
Sequence:CCGGCATCGTGATGAAGAGTGATAACTCGAGTTATCACTCTTCATCACGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074456    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_012322.1-109s1c1
Sequence:CCGGGTTGGTACTCTTCTAGGATTTCTCGAGAAATCCTAGAAGAGTACCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_012322.1-79s1c1
Sequence:CCGGCACATCGTGATGAAGAGTGATCTCGAGATCACTCTTCATCACGATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012322.2-311s21c1
Sequence:CCGGCCTGAAGTGTGAATGAGTTTCCTCGAGGAAACTCATTCACACTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428452    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012322.2-727s21c1
Sequence:CCGGCAACCGGAAATGATCACTTAGCTCGAGCTAAGTGATCATTTCCGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012322.2-100s21c1
Sequence:CCGGGGACAAATGTATAGGATCAAGCTCGAGCTTGATCCTATACATTTGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012322.2-88s21c1
Sequence:CCGGCTTAGAGCTTGTGGACAAATGCTCGAGCATTTGTCCACAAGCTCTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012322.2-179s21c1
Sequence:CCGGGACTTTGTCAATATGGTACTGCTCGAGCAGTACCATATTGACAAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012322
VALIDATED
LSM5 MISSION shRNA shRNA Plasmid DNA
LSM5 homolog, U6 small nuclear RNA associated (S. cerevisiae)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000074453    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_012322.1-398s1c1
Sequence:CCGGGCTTTGAAGATGTGTACCCATCTCGAGATGGGTACACATCTTCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_012322.1-40s1c1
Sequence:CCGGCCGTTAGAGCTTGTGGACAAACTCGAGTTTGTCCACAAGCTCTAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_012322.1-81s1c1
Sequence:CCGGCATCGTGATGAAGAGTGATAACTCGAGTTATCACTCTTCATCACGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074456    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_012322.1-109s1c1
Sequence:CCGGGTTGGTACTCTTCTAGGATTTCTCGAGAAATCCTAGAAGAGTACCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_012322.1-79s1c1
Sequence:CCGGCACATCGTGATGAAGAGTGATCTCGAGATCACTCTTCATCACGATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012322.2-311s21c1
Sequence:CCGGCCTGAAGTGTGAATGAGTTTCCTCGAGGAAACTCATTCACACTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428452    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012322.2-727s21c1
Sequence:CCGGCAACCGGAAATGATCACTTAGCTCGAGCTAAGTGATCATTTCCGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012322.2-100s21c1
Sequence:CCGGGGACAAATGTATAGGATCAAGCTCGAGCTTGATCCTATACATTTGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012322.2-88s21c1
Sequence:CCGGCTTAGAGCTTGTGGACAAATGCTCGAGCATTTGTCCACAAGCTCTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012322.2-179s21c1
Sequence:CCGGGACTTTGTCAATATGGTACTGCTCGAGCAGTACCATATTGACAAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012322
VALIDATED
LSM5 MISSION shRNA Lentiviral Transduction Particles
LSM5 homolog, U6 small nuclear RNA associated (S. cerevisiae)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000074453    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_012322.1-398s1c1
Sequence:CCGGGCTTTGAAGATGTGTACCCATCTCGAGATGGGTACACATCTTCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_012322.1-40s1c1
Sequence:CCGGCCGTTAGAGCTTGTGGACAAACTCGAGTTTGTCCACAAGCTCTAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_012322.1-81s1c1
Sequence:CCGGCATCGTGATGAAGAGTGATAACTCGAGTTATCACTCTTCATCACGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074456    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_012322.1-109s1c1
Sequence:CCGGGTTGGTACTCTTCTAGGATTTCTCGAGAAATCCTAGAAGAGTACCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_012322.1-79s1c1
Sequence:CCGGCACATCGTGATGAAGAGTGATCTCGAGATCACTCTTCATCACGATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012322.2-311s21c1
Sequence:CCGGCCTGAAGTGTGAATGAGTTTCCTCGAGGAAACTCATTCACACTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428452    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012322.2-727s21c1
Sequence:CCGGCAACCGGAAATGATCACTTAGCTCGAGCTAAGTGATCATTTCCGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012322.2-100s21c1
Sequence:CCGGGGACAAATGTATAGGATCAAGCTCGAGCTTGATCCTATACATTTGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012322.2-88s21c1
Sequence:CCGGCTTAGAGCTTGTGGACAAATGCTCGAGCATTTGTCCACAAGCTCTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012322.2-179s21c1
Sequence:CCGGGACTTTGTCAATATGGTACTGCTCGAGCAGTACCATATTGACAAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks