EMAIL THIS PAGE TO A FRIEND

LSR

lipolysis stimulated lipoprotein receptor

Synonyms: ILDR3 LISCH7
Gene ID:
Mouse(54135) lipolysis stimulated lipoprotein receptor
Rat(64355) lipolysis stimulated lipoprotein receptor
Zebrafish(553218) lipolysis stimulated lipoprotein receptor
Horse(100059229) lipolysis stimulated lipoprotein receptor
cow(508651) lipolysis stimulated lipoprotein receptor
domestic cat(101080849) lipolysis stimulated lipoprotein receptor
dog(484581) lipolysis stimulated lipoprotein receptor
sheep(101102331) lipolysis stimulated lipoprotein receptor
naked mole-rat(101702023) lipolysis stimulated lipoprotein receptor
domestic guinea pig(100720416) lipolysis stimulated lipoprotein receptor
71 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_205834 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_205834 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_205834 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_017405 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_017405 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_017405 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015925 Rosetta Predictions human pricing
NM_205834 Rosetta Predictions human pricing
NM_205835 Rosetta Predictions human pricing
NM_032616 Rosetta Predictions rat pricing
NM_017405 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015925 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00187941 predicted 584
2 SASI_Hs02_00348546 predicted 1360
3 SASI_Hs01_00187943 predicted 585
4 SASI_Hs01_00187944 predicted 242
5 SASI_Hs01_00187945 predicted 544
6 SASI_Hs01_00187946 predicted 582
7 SASI_Hs01_00187947 predicted 1288
8 SASI_Hs01_00187948 predicted 575
9 SASI_Hs01_00187949 predicted 1304
10 SASI_Hs01_00187950 predicted 362
11 SASI_Hs01_00187942 predicted 441
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_205834 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00089139 predicted 586
2 SASI_Hs02_00373459 predicted 1411
3 SASI_Hs01_00089141 predicted 584
4 SASI_Hs01_00089142 predicted 241
5 SASI_Hs01_00089143 predicted 542
6 SASI_Hs01_00089144 predicted 580
7 SASI_Hs01_00089145 predicted 1336
8 SASI_Hs01_00089146 predicted 582
9 SASI_Hs01_00089147 predicted 1363
10 SASI_Hs01_00089148 predicted 363
11 SASI_Hs01_00089140 predicted 444
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_205835 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00048420 predicted 586
2 SASI_Hs01_00048421 predicted 1208
3 SASI_Hs01_00048423 predicted 583
4 SASI_Hs01_00048424 predicted 235
5 SASI_Hs01_00048425 predicted 541
6 SASI_Hs01_00048426 predicted 587
7 SASI_Hs01_00048427 predicted 575
8 SASI_Hs01_00048428 predicted 1158
9 SASI_Hs01_00048429 predicted 371
10 SASI_Hs02_00373460 predicted 456
11 SASI_Hs01_00048422 predicted 447
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032616 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00090057 predicted 1788
2 SASI_Rn01_00090058 predicted 1115
3 SASI_Rn01_00090060 predicted 1793
4 SASI_Rn01_00090061 predicted 1254
5 SASI_Rn01_00090062 predicted 1803
6 SASI_Rn01_00090063 predicted 1188
7 SASI_Rn01_00090064 predicted 1116
8 SASI_Rn01_00090065 predicted 641
9 SASI_Rn01_00090066 predicted 820
10 SASI_Rn02_00265484 predicted 1352
11 SASI_Rn01_00090059 predicted 444
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017405 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00060006 predicted 1627
2 SASI_Mm01_00060007 predicted 1622
3 SASI_Mm01_00060008 predicted 243
4 SASI_Mm01_00060009 predicted 1072
5 SASI_Mm01_00060010 predicted 1174
6 SASI_Mm01_00060011 predicted 643
7 SASI_Mm02_00323917 predicted 663
8 SASI_Mm02_00323918 predicted 941
9 SASI_Mm01_00060012 predicted 1631
10 SASI_Mm01_00060013 predicted 478
11 SASI_Mm01_00060014 predicted 1675
12 SASI_Mm01_00060015 predicted 1016
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_205834
LSR MISSION shRNA Bacterial Glycerol Stock
lipolysis stimulated lipoprotein receptor
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_205834.2-1285s21c1
Sequence:CCGGAGGATACCCTGGAGACGTTGACTCGAGTCAACGTCTCCAGGGTATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429922    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_205834.2-1427s21c1
Sequence:CCGGATGCGGGTCCTGTACTACATGCTCGAGCATGTAGTACAGGACCCGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_205834.2-1003s21c1
Sequence:CCGGGCTCTTCGTGGTTGTGGTATGCTCGAGCATACCACAACCACGAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_205834.2-549s21c1
Sequence:CCGGTGCCCTGTACCTACCAGATGACTCGAGTCATCTGGTAGGTACAGGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_205834.1-595s1c1
Sequence:CCGGCATCTGGAAGTACAAGTCTTTCTCGAGAAAGACTTGTACTTCCAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_205834.1-2122s1c1
Sequence:CCGGGCGCAGGCTCAAGAAGAACTTCTCGAGAAGTTCTTCTTGAGCCTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_205834.1-316s1c1
Sequence:CCGGCCTAAGGTACTTTGGAAGGGACTCGAGTCCCTTCCAAAGTACCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_205834.1-802s1c1
Sequence:CCGGGAGGATTACCATCACCGGAAACTCGAGTTTCCGGTGATGGTAATCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_205834.1-1761s1c1
Sequence:CCGGCCACGAGTAATGGTGGGAGAACTCGAGTTCTCCCACCATTACTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_205834
LSR MISSION shRNA shRNA Plasmid DNA
lipolysis stimulated lipoprotein receptor
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_205834.2-1285s21c1
Sequence:CCGGAGGATACCCTGGAGACGTTGACTCGAGTCAACGTCTCCAGGGTATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429922    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_205834.2-1427s21c1
Sequence:CCGGATGCGGGTCCTGTACTACATGCTCGAGCATGTAGTACAGGACCCGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_205834.2-1003s21c1
Sequence:CCGGGCTCTTCGTGGTTGTGGTATGCTCGAGCATACCACAACCACGAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_205834.2-549s21c1
Sequence:CCGGTGCCCTGTACCTACCAGATGACTCGAGTCATCTGGTAGGTACAGGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_205834.1-595s1c1
Sequence:CCGGCATCTGGAAGTACAAGTCTTTCTCGAGAAAGACTTGTACTTCCAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_205834.1-2122s1c1
Sequence:CCGGGCGCAGGCTCAAGAAGAACTTCTCGAGAAGTTCTTCTTGAGCCTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_205834.1-316s1c1
Sequence:CCGGCCTAAGGTACTTTGGAAGGGACTCGAGTCCCTTCCAAAGTACCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_205834.1-802s1c1
Sequence:CCGGGAGGATTACCATCACCGGAAACTCGAGTTTCCGGTGATGGTAATCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_205834.1-1761s1c1
Sequence:CCGGCCACGAGTAATGGTGGGAGAACTCGAGTTCTCCCACCATTACTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_205834
LSR MISSION shRNA Lentiviral Transduction Particles
lipolysis stimulated lipoprotein receptor
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_205834.2-1285s21c1
Sequence:CCGGAGGATACCCTGGAGACGTTGACTCGAGTCAACGTCTCCAGGGTATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429922    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_205834.2-1427s21c1
Sequence:CCGGATGCGGGTCCTGTACTACATGCTCGAGCATGTAGTACAGGACCCGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_205834.2-1003s21c1
Sequence:CCGGGCTCTTCGTGGTTGTGGTATGCTCGAGCATACCACAACCACGAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_205834.2-549s21c1
Sequence:CCGGTGCCCTGTACCTACCAGATGACTCGAGTCATCTGGTAGGTACAGGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_205834.1-595s1c1
Sequence:CCGGCATCTGGAAGTACAAGTCTTTCTCGAGAAAGACTTGTACTTCCAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_205834.1-2122s1c1
Sequence:CCGGGCGCAGGCTCAAGAAGAACTTCTCGAGAAGTTCTTCTTGAGCCTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_205834.1-316s1c1
Sequence:CCGGCCTAAGGTACTTTGGAAGGGACTCGAGTCCCTTCCAAAGTACCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_205834.1-802s1c1
Sequence:CCGGGAGGATTACCATCACCGGAAACTCGAGTTTCCGGTGATGGTAATCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_205834.1-1761s1c1
Sequence:CCGGCCACGAGTAATGGTGGGAGAACTCGAGTTCTCCCACCATTACTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017405
VALIDATED
LSR MISSION shRNA Bacterial Glycerol Stock
lipolysis stimulated lipoprotein receptor
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000287694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_017405.1-247s21c1
Sequence:CCGGCCTATCGTGATCTGGAAGTATCTCGAGATACTTCCAGATCACGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_017405.1-1632s21c1
Sequence:CCGGGCGACTCTTAGAAGAGGCTTTCTCGAGAAAGCCTCTTCTAAGAGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287692    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_017405.1-95s21c1
Sequence:CCGGCCACGATCTTCGTGTGTCTTTCTCGAGAAAGACACACGAAGATCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017405.1-790s21c1
Sequence:CCGGTGTTGCCCTGAGGCCCTTTATCTCGAGATAAAGGGCCTCAGGGCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017405.1-1073s21c1
Sequence:CCGGCCATGAGGGTCCTATACTATACTCGAGTATAGTATAGGACCCTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017405.1-1517s1c1
Sequence:CCGGCCCACTATTATGATGATTTGACTCGAGTCAAATCATCATAATAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_017405.1-95s1c1
Sequence:CCGGCCACGATCTTCGTGTGTCTTTCTCGAGAAAGACACACGAAGATCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_017405.1-1632s1c1
Sequence:CCGGGCGACTCTTAGAAGAGGCTTTCTCGAGAAAGCCTCTTCTAAGAGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_017405.1-247s1c1
Sequence:CCGGCCTATCGTGATCTGGAAGTATCTCGAGATACTTCCAGATCACGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_017405.1-1385s1c1
Sequence:CCGGCCACTGAATCAGGAAGGTCTTCTCGAGAAGACCTTCCTGATTCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017405
VALIDATED
LSR MISSION shRNA shRNA Plasmid DNA
lipolysis stimulated lipoprotein receptor
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000287694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_017405.1-247s21c1
Sequence:CCGGCCTATCGTGATCTGGAAGTATCTCGAGATACTTCCAGATCACGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_017405.1-1632s21c1
Sequence:CCGGGCGACTCTTAGAAGAGGCTTTCTCGAGAAAGCCTCTTCTAAGAGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287692    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_017405.1-95s21c1
Sequence:CCGGCCACGATCTTCGTGTGTCTTTCTCGAGAAAGACACACGAAGATCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017405.1-790s21c1
Sequence:CCGGTGTTGCCCTGAGGCCCTTTATCTCGAGATAAAGGGCCTCAGGGCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017405.1-1073s21c1
Sequence:CCGGCCATGAGGGTCCTATACTATACTCGAGTATAGTATAGGACCCTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017405.1-1517s1c1
Sequence:CCGGCCCACTATTATGATGATTTGACTCGAGTCAAATCATCATAATAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_017405.1-95s1c1
Sequence:CCGGCCACGATCTTCGTGTGTCTTTCTCGAGAAAGACACACGAAGATCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_017405.1-1632s1c1
Sequence:CCGGGCGACTCTTAGAAGAGGCTTTCTCGAGAAAGCCTCTTCTAAGAGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_017405.1-247s1c1
Sequence:CCGGCCTATCGTGATCTGGAAGTATCTCGAGATACTTCCAGATCACGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_017405.1-1385s1c1
Sequence:CCGGCCACTGAATCAGGAAGGTCTTCTCGAGAAGACCTTCCTGATTCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017405
VALIDATED
LSR MISSION shRNA Lentiviral Transduction Particles
lipolysis stimulated lipoprotein receptor
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000287694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_017405.1-247s21c1
Sequence:CCGGCCTATCGTGATCTGGAAGTATCTCGAGATACTTCCAGATCACGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_017405.1-1632s21c1
Sequence:CCGGGCGACTCTTAGAAGAGGCTTTCTCGAGAAAGCCTCTTCTAAGAGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287692    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_017405.1-95s21c1
Sequence:CCGGCCACGATCTTCGTGTGTCTTTCTCGAGAAAGACACACGAAGATCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017405.1-790s21c1
Sequence:CCGGTGTTGCCCTGAGGCCCTTTATCTCGAGATAAAGGGCCTCAGGGCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017405.1-1073s21c1
Sequence:CCGGCCATGAGGGTCCTATACTATACTCGAGTATAGTATAGGACCCTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017405.1-1517s1c1
Sequence:CCGGCCCACTATTATGATGATTTGACTCGAGTCAAATCATCATAATAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_017405.1-95s1c1
Sequence:CCGGCCACGATCTTCGTGTGTCTTTCTCGAGAAAGACACACGAAGATCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_017405.1-1632s1c1
Sequence:CCGGGCGACTCTTAGAAGAGGCTTTCTCGAGAAAGCCTCTTCTAAGAGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_017405.1-247s1c1
Sequence:CCGGCCTATCGTGATCTGGAAGTATCTCGAGATACTTCCAGATCACGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_017405.1-1385s1c1
Sequence:CCGGCCACTGAATCAGGAAGGTCTTCTCGAGAAGACCTTCCTGATTCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks