EMAIL THIS PAGE TO A FRIEND

LTA

lymphotoxin alpha

Synonyms: LT TNFB TNFSF1
UniProtKB ID: P01374, Q8N4C3, Q9UKS8
Gene ID:
Human(4049) Summary: The encoded protein, a member of the tumor necrosis factor family, is a cytokine produced by lymphocytes. The protein is highly inducible, secreted, and forms heterotrimers with lymphotoxin-beta which anchor lymphotoxin-alpha to the cell surface. This protein also mediates a large variety of inflammatory, immunostimulatory, and antiviral responses, is involved in the formation of secondary lymphoid organs during development and plays a role in apoptosis. Genetic variations in this gene are associated with susceptibility to leprosy type 4, myocardial infarction, non-Hodgkin's lymphoma, and psoriatic arthritis. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Jul 2012]
Mouse(16992) lymphotoxin A
Rat(25008) lymphotoxin alpha
sheep(101123078) lymphotoxin alpha (TNF superfamily, member 1)
domestic guinea pig(100722832) lymphotoxin alpha (TNF superfamily, member 1)
naked mole-rat(101718783) lymphotoxin alpha (TNF superfamily, member 1)
Domestic Rabbit(100328931) lymphotoxin alpha (TNF superfamily, member 1)
Zebrafish(554305) lymphotoxin alpha (TNF superfamily, member 1)
cow(280845) lymphotoxin alpha (TNF superfamily, member 1)
domestic cat(101084961) lymphotoxin alpha (TNF superfamily, member 1)
dog(607183) lymphotoxin alpha (TNF superfamily, member 1)
143 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000595 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000595 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000595 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010735 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010735 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010735 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000595 Rosetta Predictions human pricing
NM_080769 Rosetta Predictions rat pricing
NM_010735 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000595 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00240586 predicted 405
2 SASI_Hs01_00240587 predicted 867
3 SASI_Hs01_00240588 predicted 325
4 SASI_Hs01_00240589 predicted 803
5 SASI_Hs01_00240590 predicted 707
6 SASI_Hs02_00302867 predicted 364
7 SASI_Hs01_00240591 predicted 717
8 SASI_Hs01_00240593 predicted 449
9 SASI_Hs01_00240594 predicted 737
10 SASI_Hs01_00240595 predicted 890
11 SASI_Hs01_00240592 predicted 678
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080769 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00044107 predicted 1043
2 SASI_Rn01_00044108 predicted 317
3 SASI_Rn01_00044109 predicted 647
4 SASI_Rn01_00044110 predicted 784
5 SASI_Rn01_00044111 predicted 942
6 SASI_Rn01_00044112 predicted 924
7 SASI_Rn01_00044113 predicted 953
8 SASI_Rn01_00044114 predicted 961
9 SASI_Rn01_00044115 predicted 774
10 SASI_Rn01_00044116 predicted 1059
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010735 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00156957 predicted 938
2 SASI_Mm01_00156958 predicted 339
3 SASI_Mm01_00156959 predicted 704
4 SASI_Mm01_00156960 predicted 801
5 SASI_Mm01_00156961 predicted 411
6 SASI_Mm01_00156962 predicted 546
7 SASI_Mm02_00319238 predicted 403
8 SASI_Mm01_00156963 predicted 604
9 SASI_Mm01_00156965 predicted 451
10 SASI_Mm01_00156966 predicted 1055
11 SASI_Mm01_00156964 predicted 958
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000595
LTA MISSION shRNA Bacterial Glycerol Stock
lymphotoxin alpha
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000058203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000595.2-449s1c1
Sequence:CCGGCAGTGGCATCTACTTCGTCTACTCGAGTAGACGAAGTAGATGCCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000595.2-295s1c1
Sequence:CCGGCCAAGATGCATCTTGCCCACACTCGAGTGTGGGCAAGATGCATCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000595.2-419s1c1
Sequence:CCGGCTTGAGCAACAATTCTCTCCTCTCGAGAGGAGAGAATTGTTGCTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000595.2-545s1c1
Sequence:CCGGCCAGCTCTTCTCCTCCCAGTACTCGAGTACTGGGAGGAGAAGAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000595.2-716s1c1
Sequence:CCGGCCTCAGCCCTAGTACTGTCTTCTCGAGAAGACAGTACTAGGGCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000595.2-721s21c1
Sequence:CCGGGCCCTAGTACTGTCTTCTTTGCTCGAGCAAAGAAGACAGTACTAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364188    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000595.2-888s21c1
Sequence:CCGGGATCAAGTCACCGGAGCTTTCCTCGAGGAAAGCTCCGGTGACTTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364191    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000595.2-589s21c1
Sequence:CCGGGCTCCCAGAAGATGGTGTATCCTCGAGGATACACCATCTTCTGGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364189    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000595.2-815s21c1
Sequence:CCGGTGCCTCCATTCTGACCATTTCCTCGAGGAAATGGTCAGAATGGAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000595
LTA MISSION shRNA shRNA Plasmid DNA
lymphotoxin alpha
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000058203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000595.2-449s1c1
Sequence:CCGGCAGTGGCATCTACTTCGTCTACTCGAGTAGACGAAGTAGATGCCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000595.2-295s1c1
Sequence:CCGGCCAAGATGCATCTTGCCCACACTCGAGTGTGGGCAAGATGCATCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000595.2-419s1c1
Sequence:CCGGCTTGAGCAACAATTCTCTCCTCTCGAGAGGAGAGAATTGTTGCTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000595.2-545s1c1
Sequence:CCGGCCAGCTCTTCTCCTCCCAGTACTCGAGTACTGGGAGGAGAAGAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000595.2-716s1c1
Sequence:CCGGCCTCAGCCCTAGTACTGTCTTCTCGAGAAGACAGTACTAGGGCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000595.2-721s21c1
Sequence:CCGGGCCCTAGTACTGTCTTCTTTGCTCGAGCAAAGAAGACAGTACTAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364188    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000595.2-888s21c1
Sequence:CCGGGATCAAGTCACCGGAGCTTTCCTCGAGGAAAGCTCCGGTGACTTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364191    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000595.2-589s21c1
Sequence:CCGGGCTCCCAGAAGATGGTGTATCCTCGAGGATACACCATCTTCTGGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364189    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000595.2-815s21c1
Sequence:CCGGTGCCTCCATTCTGACCATTTCCTCGAGGAAATGGTCAGAATGGAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000595
LTA MISSION shRNA Lentiviral Transduction Particles
lymphotoxin alpha
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000058203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000595.2-449s1c1
Sequence:CCGGCAGTGGCATCTACTTCGTCTACTCGAGTAGACGAAGTAGATGCCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000595.2-295s1c1
Sequence:CCGGCCAAGATGCATCTTGCCCACACTCGAGTGTGGGCAAGATGCATCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000595.2-419s1c1
Sequence:CCGGCTTGAGCAACAATTCTCTCCTCTCGAGAGGAGAGAATTGTTGCTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000595.2-545s1c1
Sequence:CCGGCCAGCTCTTCTCCTCCCAGTACTCGAGTACTGGGAGGAGAAGAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000595.2-716s1c1
Sequence:CCGGCCTCAGCCCTAGTACTGTCTTCTCGAGAAGACAGTACTAGGGCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000595.2-721s21c1
Sequence:CCGGGCCCTAGTACTGTCTTCTTTGCTCGAGCAAAGAAGACAGTACTAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364188    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000595.2-888s21c1
Sequence:CCGGGATCAAGTCACCGGAGCTTTCCTCGAGGAAAGCTCCGGTGACTTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364191    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000595.2-589s21c1
Sequence:CCGGGCTCCCAGAAGATGGTGTATCCTCGAGGATACACCATCTTCTGGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364189    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000595.2-815s21c1
Sequence:CCGGTGCCTCCATTCTGACCATTTCCTCGAGGAAATGGTCAGAATGGAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010735
LTA MISSION shRNA Bacterial Glycerol Stock
lymphotoxin alpha
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000068038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010735.1-423s1c1
Sequence:CCGGTGGCTTCTCTTTGAGCAACAACTCGAGTTGTTGCTCAAAGAGAAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010735.1-613s1c1
Sequence:CCGGTCTGTGTATCCGGGACTTCAACTCGAGTTGAAGTCCCGGATACACAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010735.1-468s1c1
Sequence:CCGGCCTCTACTTTGTCTACTCCCACTCGAGTGGGAGTAGACAAAGTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010735.1-547s1c1
Sequence:CCGGGCACACGAGGTCCAGCTCTTTCTCGAGAAAGAGCTGGACCTCGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010735.1-750s1c1
Sequence:CCGGCTTTGGAGCCTTTGCACTGTACTCGAGTACAGTGCAAAGGCTCCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000368877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010735.2-799s21c1
Sequence:CCGGCTTTGCACTGTAGATTCTAAACTCGAGTTTAGAATCTACAGTGCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010735.2-455s21c1
Sequence:CCGGCTCCGACATGGCTTCTCTTTGCTCGAGCAAAGAGAAGCCATGTCGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362655    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010735.2-1218s21c1
Sequence:CCGGCTCAGACAGGACCCATCTAAGCTCGAGCTTAGATGGGTCCTGTCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000368850    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010735.2-845s21c1
Sequence:CCGGCTCCATCCTGACCGTTGTTTCCTCGAGGAAACAACGGTCAGGATGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010735
LTA MISSION shRNA shRNA Plasmid DNA
lymphotoxin alpha
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000068038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010735.1-423s1c1
Sequence:CCGGTGGCTTCTCTTTGAGCAACAACTCGAGTTGTTGCTCAAAGAGAAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010735.1-613s1c1
Sequence:CCGGTCTGTGTATCCGGGACTTCAACTCGAGTTGAAGTCCCGGATACACAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010735.1-468s1c1
Sequence:CCGGCCTCTACTTTGTCTACTCCCACTCGAGTGGGAGTAGACAAAGTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010735.1-547s1c1
Sequence:CCGGGCACACGAGGTCCAGCTCTTTCTCGAGAAAGAGCTGGACCTCGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010735.1-750s1c1
Sequence:CCGGCTTTGGAGCCTTTGCACTGTACTCGAGTACAGTGCAAAGGCTCCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000368877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010735.2-799s21c1
Sequence:CCGGCTTTGCACTGTAGATTCTAAACTCGAGTTTAGAATCTACAGTGCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010735.2-455s21c1
Sequence:CCGGCTCCGACATGGCTTCTCTTTGCTCGAGCAAAGAGAAGCCATGTCGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362655    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010735.2-1218s21c1
Sequence:CCGGCTCAGACAGGACCCATCTAAGCTCGAGCTTAGATGGGTCCTGTCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000368850    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010735.2-845s21c1
Sequence:CCGGCTCCATCCTGACCGTTGTTTCCTCGAGGAAACAACGGTCAGGATGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010735
LTA MISSION shRNA Lentiviral Transduction Particles
lymphotoxin alpha
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000068038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010735.1-423s1c1
Sequence:CCGGTGGCTTCTCTTTGAGCAACAACTCGAGTTGTTGCTCAAAGAGAAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010735.1-613s1c1
Sequence:CCGGTCTGTGTATCCGGGACTTCAACTCGAGTTGAAGTCCCGGATACACAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010735.1-468s1c1
Sequence:CCGGCCTCTACTTTGTCTACTCCCACTCGAGTGGGAGTAGACAAAGTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010735.1-547s1c1
Sequence:CCGGGCACACGAGGTCCAGCTCTTTCTCGAGAAAGAGCTGGACCTCGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010735.1-750s1c1
Sequence:CCGGCTTTGGAGCCTTTGCACTGTACTCGAGTACAGTGCAAAGGCTCCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000368877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010735.2-799s21c1
Sequence:CCGGCTTTGCACTGTAGATTCTAAACTCGAGTTTAGAATCTACAGTGCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010735.2-455s21c1
Sequence:CCGGCTCCGACATGGCTTCTCTTTGCTCGAGCAAAGAGAAGCCATGTCGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362655    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010735.2-1218s21c1
Sequence:CCGGCTCAGACAGGACCCATCTAAGCTCGAGCTTAGATGGGTCCTGTCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000368850    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010735.2-845s21c1
Sequence:CCGGCTCCATCCTGACCGTTGTTTCCTCGAGGAAACAACGGTCAGGATGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks